EMAIL THIS PAGE TO A FRIEND

AGTR1

angiotensin II receptor, type 1

136 Gene Product Result for
Synonyms: AG2S AGTR1A AGTR1B AT1 AT1AR AT1B AT1BR AT1R AT2R1 AT2R1A AT2R1B HAT1R
UniProtKB ID: P30556, Q13725
Gene ID:
Human(185) Summary: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012]
naked mole-rat(101714068) angiotensin II receptor, type 1
domestic guinea pig(100192325) angiotensin II receptor, type 1
sheep(443107) angiotensin II receptor, type 1
Domestic Rabbit(100009164) angiotensin II receptor, type 1
chicken(396065) angiotensin II receptor, type 1
domestic cat(101082936) angiotensin II receptor, type 1
dog(403836) angiotensin II receptor, type 1
cow(281607) angiotensin II receptor, type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C4042 Captopril ≥98% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032049 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090121 MISSION® esiRNA esiRNA human AGTR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000685 Rosetta Predictions human pricing
NM_004835 Rosetta Predictions human pricing
NM_009585 Rosetta Predictions human pricing
NM_031850 Rosetta Predictions human pricing
NM_032049 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206672 predicted 639
2 SASI_Hs01_00206673 predicted 872
3 SASI_Hs01_00206674 predicted 1245
4 SASI_Hs01_00206675 predicted 1017
5 SASI_Hs01_00206677 predicted 856
6 SASI_Hs01_00206678 predicted 807
7 SASI_Hs02_00303086 predicted 797
8 SASI_Hs02_00303087 predicted 919
9 SASI_Hs01_00206680 predicted 1075
10 SASI_Hs01_00206681 predicted 677
11 SASI_Hs01_00206676 predicted 762
12 SASI_Hs01_00206679 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209696 predicted 608
2 SASI_Hs01_00209697 predicted 841
3 SASI_Hs01_00209698 predicted 1213
4 SASI_Hs01_00209699 predicted 992
5 SASI_Hs01_00209701 predicted 833
6 SASI_Hs01_00209702 predicted 780
7 SASI_Hs02_00338409 predicted 774
8 SASI_Hs02_00338410 predicted 886
9 SASI_Hs01_00209704 predicted 1054
10 SASI_Hs01_00209705 predicted 647
11 SASI_Hs01_00209700 predicted 743
12 SASI_Hs01_00209703 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073903 predicted 551
2 SASI_Hs01_00073904 predicted 783
3 SASI_Hs01_00073905 predicted 1160
4 SASI_Hs01_00073906 predicted 936
5 SASI_Hs01_00073908 predicted 775
6 SASI_Hs01_00073909 predicted 720
7 SASI_Hs02_00343510 predicted 722
8 SASI_Hs02_00343511 predicted 832
9 SASI_Hs01_00073911 predicted 990
10 SASI_Hs01_00073912 predicted 591
11 SASI_Hs01_00073907 predicted 682
12 SASI_Hs01_00073910 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138974 predicted 693
2 SASI_Hs01_00138975 predicted 922
3 SASI_Hs01_00138976 predicted 1302
4 SASI_Hs01_00138977 predicted 1076
5 SASI_Hs01_00138979 predicted 915
6 SASI_Hs01_00138980 predicted 860
7 SASI_Hs02_00358953 predicted 855
8 SASI_Hs02_00358954 predicted 976
9 SASI_Hs01_00138982 predicted 1129
10 SASI_Hs01_00138983 predicted 730
11 SASI_Hs01_00138978 predicted 828
12 SASI_Hs01_00138981 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202007 predicted 506
2 SASI_Hs01_00202008 predicted 737
3 SASI_Hs01_00202009 predicted 1119
4 SASI_Hs01_00202010 predicted 892
5 SASI_Hs01_00202012 predicted 733
6 SASI_Hs01_00202013 predicted 681
7 SASI_Hs02_00359249 predicted 671
8 SASI_Hs02_00359250 predicted 790
9 SASI_Hs01_00202015 predicted 952
10 SASI_Hs01_00202016 predicted 549
11 SASI_Hs01_00202011 predicted 604
12 SASI_Hs01_00202014 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032049
AGTR1 MISSION shRNA Bacterial Glycerol Stock
angiotensin II receptor, type 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-736s21c1
Sequence:CCGGGGCCAGTTTGCCAGCTATAATCTCGAGATTATAGCTGGCAAACTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-774s21c1
Sequence:CCGGTCATTGAGAACACCAATATTACTCGAGTAATATTGGTGTTCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-402s21c1
Sequence:CCGGGCTTGGTGGTGATAGTCATTTCTCGAGAAATGACTATCACCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-1119s21c1
Sequence:CCGGTCACCATTTGTATAGCTTATTCTCGAGAATAAGCTATACAAATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032049.1-1685s1c1
Sequence:CCGGCCAGATTGTTCTGTCCAGTTTCTCGAGAAACTGGACAGAACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-596s1c1
Sequence:CCGGCCTGGCTATTGTTCACCCAATCTCGAGATTGGGTGAACAATAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-698s1c1
Sequence:CCGGGCCAGCTATAATCCATCGAAACTCGAGTTTCGATGGATTATAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-1237s1c1
Sequence:CCGGCCTCAGATAATGTAAGCTCATCTCGAGATGAGCTTACATTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-876s1c1
Sequence:CCGGGCCCTAAAGAAGGCTTATGAACTCGAGTTCATAAGCCTTCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032049
AGTR1 MISSION shRNA shRNA Plasmid DNA
angiotensin II receptor, type 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-736s21c1
Sequence:CCGGGGCCAGTTTGCCAGCTATAATCTCGAGATTATAGCTGGCAAACTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-774s21c1
Sequence:CCGGTCATTGAGAACACCAATATTACTCGAGTAATATTGGTGTTCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-402s21c1
Sequence:CCGGGCTTGGTGGTGATAGTCATTTCTCGAGAAATGACTATCACCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-1119s21c1
Sequence:CCGGTCACCATTTGTATAGCTTATTCTCGAGAATAAGCTATACAAATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032049.1-1685s1c1
Sequence:CCGGCCAGATTGTTCTGTCCAGTTTCTCGAGAAACTGGACAGAACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-596s1c1
Sequence:CCGGCCTGGCTATTGTTCACCCAATCTCGAGATTGGGTGAACAATAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-698s1c1
Sequence:CCGGGCCAGCTATAATCCATCGAAACTCGAGTTTCGATGGATTATAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-1237s1c1
Sequence:CCGGCCTCAGATAATGTAAGCTCATCTCGAGATGAGCTTACATTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-876s1c1
Sequence:CCGGGCCCTAAAGAAGGCTTATGAACTCGAGTTCATAAGCCTTCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032049
AGTR1 MISSION shRNA Lentiviral Transduction Particles
angiotensin II receptor, type 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-736s21c1
Sequence:CCGGGGCCAGTTTGCCAGCTATAATCTCGAGATTATAGCTGGCAAACTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-774s21c1
Sequence:CCGGTCATTGAGAACACCAATATTACTCGAGTAATATTGGTGTTCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-402s21c1
Sequence:CCGGGCTTGGTGGTGATAGTCATTTCTCGAGAAATGACTATCACCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032049.2-1119s21c1
Sequence:CCGGTCACCATTTGTATAGCTTATTCTCGAGAATAAGCTATACAAATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032049.1-1685s1c1
Sequence:CCGGCCAGATTGTTCTGTCCAGTTTCTCGAGAAACTGGACAGAACAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-596s1c1
Sequence:CCGGCCTGGCTATTGTTCACCCAATCTCGAGATTGGGTGAACAATAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-698s1c1
Sequence:CCGGGCCAGCTATAATCCATCGAAACTCGAGTTTCGATGGATTATAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-1237s1c1
Sequence:CCGGCCTCAGATAATGTAAGCTCATCTCGAGATGAGCTTACATTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032049.1-876s1c1
Sequence:CCGGGCCCTAAAGAAGGCTTATGAACTCGAGTTCATAAGCCTTCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks