EMAIL THIS PAGE TO A FRIEND

AGTR2

angiotensin II receptor, type 2

89 Gene Product Result for
Synonyms: AT2 ATGR2 MRX88
UniProtKB ID: P50052, B2R9V1, Q13016, Q6FGY7
Gene ID:
Human(186) Summary: The protein encoded by this gene belongs to the G-protein coupled receptor 1 family, and functions as a receptor for angiotensin II. It is an intergral membrane protein that is highly expressed in fetus, but scantily in adult tissues, except brain, adrenal medulla, and atretic ovary. This receptor has been shown to mediate programmed cell death and this apoptotic function may play an important role in developmental biology and pathophysiology. Mutations in this gene are been associated with X-linked mental retardation. [provided by RefSeq, Jan 2010]
Mouse(11609) angiotensin II receptor, type 2
Rat(24182) angiotensin II receptor, type 2
Zebrafish(503772) angiotensin II receptor, type 2
cow(407157) angiotensin II receptor, type 2
Horse(100053878) angiotensin II receptor, type 2
domestic cat(101080516) angiotensin II receptor, type 2
dog(403835) angiotensin II receptor, type 2
chicken(428708) angiotensin II receptor, type 2
domestic guinea pig(100730813) angiotensin II receptor, type 2
Domestic Rabbit(100009329) angiotensin II receptor, type 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303887 ANTI-AGTR2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB3500098 Anti-AGTR2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB2107484 Anti-AGTR2 antibody produced in rabbit affinity isolated antibody rabbit, human, horse
ELISA, western blot pricing
SAB2900440 Anti-AGTR2 antibody produced in rabbit affinity isolated antibody mouse, rat, monkey, human, bovine, dog, sheep, hamster, horse, pig
immunohistochemistry pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C160 CGP-42112A ≥95%, synthetic, solid human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A9900 [Sar1, Thr8]-Angiotensin II acetate salt hydrate ≥97% (HPLC) human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C4042 Captopril ≥98% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000686 Rosetta Predictions human pricing
NM_012494 Rosetta Predictions rat pricing
NM_007429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199874 predicted 333
2 SASI_Hs01_00199875 predicted 273
3 SASI_Hs01_00199876 predicted 1136
4 SASI_Hs01_00199877 predicted 313
5 SASI_Hs01_00199878 predicted 323
6 SASI_Hs01_00199879 predicted 1083
7 SASI_Hs01_00199880 predicted 1069
8 SASI_Hs01_00199881 predicted 286
9 SASI_Hs01_00199882 predicted 327
10 SASI_Hs01_00199883 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259530 predicted 837
2 SASI_Rn01_00081074 predicted 686
3 SASI_Rn01_00081075 predicted 658
4 SASI_Rn01_00081076 predicted 653
5 SASI_Rn02_00259531 predicted 674
6 SASI_Rn02_00259532 predicted 749
7 SASI_Rn02_00259533 predicted 843
8 SASI_Rn01_00081081 predicted 769
9 SASI_Rn02_00259534 predicted 842
10 SASI_Rn02_00259535 predicted 857
11 SASI_Rn01_00081073 predicted 1297
12 SASI_Rn01_00081077 predicted 281
13 SASI_Rn01_00081078 predicted 232
14 SASI_Rn01_00081079 predicted 884
15 SASI_Rn01_00081080 predicted 1131
16 SASI_Rn01_00081082 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069852 predicted 1318
2 SASI_Mm01_00069853 predicted 824
3 SASI_Mm02_00311585 predicted 850
4 SASI_Mm01_00069854 predicted 294
5 SASI_Mm01_00069855 predicted 1240
6 SASI_Mm01_00069856 predicted 1092
7 SASI_Mm02_00311586 predicted 939
8 SASI_Mm01_00069859 predicted 1155
9 SASI_Mm01_00069860 predicted 244
10 SASI_Mm01_00069861 predicted 1259
11 SASI_Mm01_00069857 predicted 906
12 SASI_Mm01_00069858 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007429
AGTR2 MISSION shRNA Bacterial Glycerol Stock
angiotensin II receptor, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-1229s1c1
Sequence:CCGGCTTAGAGAAATGGACACCTTTCTCGAGAAAGGTGTCCATTTCTCTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-270s1c1
Sequence:CCGGGCTCACACAAACCATCAGATACTCGAGTATCTGATGGTTTGTGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-259s1c1
Sequence:CCGGCGCCTTTAATTGCTCACACAACTCGAGTTGTGTGAGCAATTAAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-595s1c1
Sequence:CCGGCCAATCGGTCATCTACCCTTTCTCGAGAAAGGGTAGATGACCGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-956s1c1
Sequence:CCGGGCATTCATCATTTGCTGGCTTCTCGAGAAGCCAGCAAATGATGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007429
AGTR2 MISSION shRNA shRNA Plasmid DNA
angiotensin II receptor, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-1229s1c1
Sequence:CCGGCTTAGAGAAATGGACACCTTTCTCGAGAAAGGTGTCCATTTCTCTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-270s1c1
Sequence:CCGGGCTCACACAAACCATCAGATACTCGAGTATCTGATGGTTTGTGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-259s1c1
Sequence:CCGGCGCCTTTAATTGCTCACACAACTCGAGTTGTGTGAGCAATTAAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-595s1c1
Sequence:CCGGCCAATCGGTCATCTACCCTTTCTCGAGAAAGGGTAGATGACCGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-956s1c1
Sequence:CCGGGCATTCATCATTTGCTGGCTTCTCGAGAAGCCAGCAAATGATGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007429
AGTR2 MISSION shRNA Lentiviral Transduction Particles
angiotensin II receptor, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-1229s1c1
Sequence:CCGGCTTAGAGAAATGGACACCTTTCTCGAGAAAGGTGTCCATTTCTCTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-270s1c1
Sequence:CCGGGCTCACACAAACCATCAGATACTCGAGTATCTGATGGTTTGTGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-259s1c1
Sequence:CCGGCGCCTTTAATTGCTCACACAACTCGAGTTGTGTGAGCAATTAAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-595s1c1
Sequence:CCGGCCAATCGGTCATCTACCCTTTCTCGAGAAAGGGTAGATGACCGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007429.2-956s1c1
Sequence:CCGGGCATTCATCATTTGCTGGCTTCTCGAGAAGCCAGCAAATGATGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000686
AGTR2 MISSION shRNA Bacterial Glycerol Stock
angiotensin II receptor, type 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1094s1c1
Sequence:CCGGGCTGCGTTAATCCGTTTCTGTCTCGAGACAGAAACGGATTAACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1151s1c1
Sequence:CCGGGCAGTGTGTTTAGGGTTCCAACTCGAGTTGGAACCCTAAACACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-450s1c1
Sequence:CCGGTCTTCCTCTATGGGCAACCTACTCGAGTAGGTTGCCCATAGAGGAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-760s1c1
Sequence:CCGGCCACCTGAGAAATATGCCCAACTCGAGTTGGGCATATTTCTCAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000686.x-2406s1c1
Sequence:CCGGGTATGATTCTATGGAGCTATTCTCGAGAATAGCTCCATAGAATCATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1497s21c1
Sequence:CCGGTGTCATTAGTGAGACATATTTCTCGAGAAATATGTCTCACTAATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-500s21c1
Sequence:CCGGCTCTATGGGCAACCTATTATTCTCGAGAATAATAGGTTGCCCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1726s21c1
Sequence:CCGGCACTTCTAAGTTGAGTATATTCTCGAGAATATACTCAACTTAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-1130s21c1
Sequence:CCGGTCACCAACAGCTGCGTTAATCCTCGAGGATTAACGCAGCTGTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000686
AGTR2 MISSION shRNA shRNA Plasmid DNA
angiotensin II receptor, type 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1094s1c1
Sequence:CCGGGCTGCGTTAATCCGTTTCTGTCTCGAGACAGAAACGGATTAACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1151s1c1
Sequence:CCGGGCAGTGTGTTTAGGGTTCCAACTCGAGTTGGAACCCTAAACACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-450s1c1
Sequence:CCGGTCTTCCTCTATGGGCAACCTACTCGAGTAGGTTGCCCATAGAGGAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-760s1c1
Sequence:CCGGCCACCTGAGAAATATGCCCAACTCGAGTTGGGCATATTTCTCAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000686.x-2406s1c1
Sequence:CCGGGTATGATTCTATGGAGCTATTCTCGAGAATAGCTCCATAGAATCATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1497s21c1
Sequence:CCGGTGTCATTAGTGAGACATATTTCTCGAGAAATATGTCTCACTAATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-500s21c1
Sequence:CCGGCTCTATGGGCAACCTATTATTCTCGAGAATAATAGGTTGCCCATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1726s21c1
Sequence:CCGGCACTTCTAAGTTGAGTATATTCTCGAGAATATACTCAACTTAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-1130s21c1
Sequence:CCGGTCACCAACAGCTGCGTTAATCCTCGAGGATTAACGCAGCTGTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000686
AGTR2 MISSION shRNA Lentiviral Transduction Particles
angiotensin II receptor, type 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1094s1c1
Sequence:CCGGGCTGCGTTAATCCGTTTCTGTCTCGAGACAGAAACGGATTAACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-1151s1c1
Sequence:CCGGGCAGTGTGTTTAGGGTTCCAACTCGAGTTGGAACCCTAAACACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-450s1c1
Sequence:CCGGTCTTCCTCTATGGGCAACCTACTCGAGTAGGTTGCCCATAGAGGAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000686.x-760s1c1
Sequence:CCGGCCACCTGAGAAATATGCCCAACTCGAGTTGGGCATATTTCTCAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000686.x-2406s1c1
Sequence:CCGGGTATGATTCTATGGAGCTATTCTCGAGAATAGCTCCATAGAATCATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1497s21c1
Sequence:CCGGTGTCATTAGTGAGACATATTTCTCGAGAAATATGTCTCACTAATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-500s21c1
Sequence:CCGGCTCTATGGGCAACCTATTATTCTCGAGAATAATAGGTTGCCCATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000686.4-1726s21c1
Sequence:CCGGCACTTCTAAGTTGAGTATATTCTCGAGAATATACTCAACTTAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000686.4-1130s21c1
Sequence:CCGGTCACCAACAGCTGCGTTAATCCTCGAGGATTAACGCAGCTGTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)