EMAIL THIS PAGE TO A FRIEND

AGTRAP

angiotensin II receptor-associated protein

108 Gene Product Result for
Synonyms: ATRAP
Gene ID:
Human(57085) Summary: This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11610) angiotensin II, type I receptor-associated protein
Rat(298646) angiotensin II receptor-associated protein
sheep(101111567) angiotensin II receptor-associated protein
naked mole-rat(101720160) angiotensin II receptor-associated protein
domestic guinea pig(100715988) angiotensin II receptor-associated protein
Zebrafish(793937) angiotensin II receptor-associated protein
chicken(419491) angiotensin II receptor-associated protein
cow(508521) angiotensin II receptor-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A9900 [Sar1, Thr8]-Angiotensin II acetate salt hydrate ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040194 Rosetta Predictions human pricing
NM_001040195 Rosetta Predictions human pricing
NM_001040196 Rosetta Predictions human pricing
NM_001040197 Rosetta Predictions human pricing
NM_020350 Rosetta Predictions human pricing
NM_001007654 Rosetta Predictions rat pricing
NM_009642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137272 predicted 737
2 SASI_Hs01_00137273 predicted 901
3 SASI_Hs01_00137274 predicted 883
4 SASI_Hs02_00308897 predicted 878
5 SASI_Hs02_00308898 predicted 785
6 SASI_Hs01_00137275 predicted 793
7 SASI_Hs01_00137276 predicted 899
8 SASI_Hs01_00137277 predicted 870
9 SASI_Hs01_00137278 predicted 856
10 SASI_Hs01_00137280 predicted 740
11 SASI_Hs01_00137271 predicted 696
12 SASI_Hs01_00137279 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099107 predicted 702
2 SASI_Hs01_00099108 predicted 864
3 SASI_Hs01_00099109 predicted 848
4 SASI_Hs02_00308899 predicted 844
5 SASI_Hs02_00308900 predicted 752
6 SASI_Hs01_00099110 predicted 751
7 SASI_Hs01_00099111 predicted 868
8 SASI_Hs01_00099112 predicted 835
9 SASI_Hs01_00099113 predicted 824
10 SASI_Hs01_00099115 predicted 701
11 SASI_Hs01_00099106 predicted 670
12 SASI_Hs01_00099114 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035877 predicted 826
2 SASI_Hs01_00035878 predicted 995
3 SASI_Hs01_00035879 predicted 983
4 SASI_Hs02_00308901 predicted 976
5 SASI_Hs02_00308902 predicted 876
6 SASI_Hs01_00035880 predicted 886
7 SASI_Hs01_00035881 predicted 993
8 SASI_Hs01_00035882 predicted 968
9 SASI_Hs01_00035883 predicted 953
10 SASI_Hs01_00035885 predicted 839
11 SASI_Hs01_00035876 predicted 792
12 SASI_Hs01_00035884 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192055 predicted 850
2 SASI_Hs01_00192056 predicted 1019
3 SASI_Hs01_00192057 predicted 1004
4 SASI_Hs02_00308903 predicted 997
5 SASI_Hs02_00308904 predicted 904
6 SASI_Hs01_00192058 predicted 908
7 SASI_Hs01_00192059 predicted 1016
8 SASI_Hs01_00192060 predicted 991
9 SASI_Hs01_00192061 predicted 982
10 SASI_Hs01_00192063 predicted 859
11 SASI_Hs01_00192054 predicted 819
12 SASI_Hs01_00192062 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241912 predicted 755
2 SASI_Hs01_00241913 predicted 920
3 SASI_Hs01_00241914 predicted 908
4 SASI_Hs02_00353286 predicted 902
5 SASI_Hs02_00353287 predicted 804
6 SASI_Hs01_00241915 predicted 812
7 SASI_Hs01_00241916 predicted 925
8 SASI_Hs01_00241917 predicted 894
9 SASI_Hs01_00241918 predicted 881
10 SASI_Hs01_00241920 predicted 758
11 SASI_Hs01_00241911 predicted 718
12 SASI_Hs01_00241919 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107665 predicted 711
2 SASI_Rn01_00107666 predicted 429
3 SASI_Rn02_00198778 predicted 914
4 SASI_Rn01_00107667 predicted 640
5 SASI_Rn01_00107668 predicted 242
6 SASI_Rn01_00107669 predicted 681
7 SASI_Rn01_00107670 predicted 604
8 SASI_Rn01_00107671 predicted 800
9 SASI_Rn01_00107673 predicted 977
10 SASI_Rn01_00107674 predicted 400
11 SASI_Rn01_00107672 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316612 predicted 763
2 SASI_Mm02_00316613 predicted 783
3 SASI_Mm02_00316614 predicted 418
4 SASI_Mm02_00316615 predicted 751
5 SASI_Mm02_00316616 predicted 811
6 SASI_Mm02_00316617 predicted 510
7 SASI_Mm02_00316618 predicted 396
8 SASI_Mm02_00316619 predicted 523
9 SASI_Mm02_00316620 predicted 316
10 SASI_Mm02_00316621 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020350
VALIDATED
AGTRAP MISSION shRNA Bacterial Glycerol Stock
angiotensin II receptor-associated protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-153s21c1
Sequence:CCGGTGATTCTCCTAGGTCACTGGCCTCGAGGCCAGTGACCTAGGAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-267s21c1
Sequence:CCGGGGGACTCCATCGACGCCATAACTCGAGTTATGGCGTCGATGGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020350.4-691s21c1
Sequence:CCGGGGACCTAAGATGGAATGTGTCCTCGAGGACACATTCCATCTTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-583s21c1
Sequence:CCGGTCAAGATGCCCGAGGGTACTGCTCGAGCAGTACCCTCGGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-208s1c1
Sequence:CCGGCGACGCCATAAGCATGTTTCTCTCGAGAGAAACATGCTTATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-124s1c1
Sequence:CCGGCATTGTATTCTCAGGCTCCTACTCGAGTAGGAGCCTGAGAATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-443s1c1
Sequence:CCGGCGTAGTGCCTACCAGACGATTCTCGAGAATCGTCTGGTAGGCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-414s1c1
Sequence:CCGGACACTGGTTTCCTTGGGTCTTCTCGAGAAGACCCAAGGAAACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-212s1c1
Sequence:CCGGGCCATAAGCATGTTTCTGGGTCTCGAGACCCAGAAACATGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020350
VALIDATED
AGTRAP MISSION shRNA shRNA Plasmid DNA
angiotensin II receptor-associated protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-153s21c1
Sequence:CCGGTGATTCTCCTAGGTCACTGGCCTCGAGGCCAGTGACCTAGGAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-267s21c1
Sequence:CCGGGGGACTCCATCGACGCCATAACTCGAGTTATGGCGTCGATGGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020350.4-691s21c1
Sequence:CCGGGGACCTAAGATGGAATGTGTCCTCGAGGACACATTCCATCTTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-583s21c1
Sequence:CCGGTCAAGATGCCCGAGGGTACTGCTCGAGCAGTACCCTCGGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-208s1c1
Sequence:CCGGCGACGCCATAAGCATGTTTCTCTCGAGAGAAACATGCTTATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-124s1c1
Sequence:CCGGCATTGTATTCTCAGGCTCCTACTCGAGTAGGAGCCTGAGAATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-443s1c1
Sequence:CCGGCGTAGTGCCTACCAGACGATTCTCGAGAATCGTCTGGTAGGCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-414s1c1
Sequence:CCGGACACTGGTTTCCTTGGGTCTTCTCGAGAAGACCCAAGGAAACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-212s1c1
Sequence:CCGGGCCATAAGCATGTTTCTGGGTCTCGAGACCCAGAAACATGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020350
VALIDATED
AGTRAP MISSION shRNA Lentiviral Transduction Particles
angiotensin II receptor-associated protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-153s21c1
Sequence:CCGGTGATTCTCCTAGGTCACTGGCCTCGAGGCCAGTGACCTAGGAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-267s21c1
Sequence:CCGGGGGACTCCATCGACGCCATAACTCGAGTTATGGCGTCGATGGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020350.4-691s21c1
Sequence:CCGGGGACCTAAGATGGAATGTGTCCTCGAGGACACATTCCATCTTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020350.4-583s21c1
Sequence:CCGGTCAAGATGCCCGAGGGTACTGCTCGAGCAGTACCCTCGGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-208s1c1
Sequence:CCGGCGACGCCATAAGCATGTTTCTCTCGAGAGAAACATGCTTATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-124s1c1
Sequence:CCGGCATTGTATTCTCAGGCTCCTACTCGAGTAGGAGCCTGAGAATACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-443s1c1
Sequence:CCGGCGTAGTGCCTACCAGACGATTCTCGAGAATCGTCTGGTAGGCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020350.3-414s1c1
Sequence:CCGGACACTGGTTTCCTTGGGTCTTCTCGAGAAGACCCAAGGAAACCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020350.3-212s1c1
Sequence:CCGGGCCATAAGCATGTTTCTGGGTCTCGAGACCCAGAAACATGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009642
VALIDATED
AGTRAP MISSION shRNA Bacterial Glycerol Stock
angiotensin II receptor-associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009642.3-1291s1c1
Sequence:CCGGCCTCTGAATCTAAGTGACTATCTCGAGATAGTCACTTAGATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-502s1c1
Sequence:CCGGCCTACCAGACAATTGACTCATCTCGAGATGAGTCAATTGTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-505s1c1
Sequence:CCGGACCAGACAATTGACTCATCATCTCGAGATGATGAGTCAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-304s1c1
Sequence:CCGGTCCTGGACATTATCTACATTACTCGAGTAATGTAGATAATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-176s1c1
Sequence:CCGGCTTGGTGTTCTCAAGCTCCTACTCGAGTAGGAGCTTGAGAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009642
VALIDATED
AGTRAP MISSION shRNA shRNA Plasmid DNA
angiotensin II receptor-associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009642.3-1291s1c1
Sequence:CCGGCCTCTGAATCTAAGTGACTATCTCGAGATAGTCACTTAGATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-502s1c1
Sequence:CCGGCCTACCAGACAATTGACTCATCTCGAGATGAGTCAATTGTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-505s1c1
Sequence:CCGGACCAGACAATTGACTCATCATCTCGAGATGATGAGTCAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-304s1c1
Sequence:CCGGTCCTGGACATTATCTACATTACTCGAGTAATGTAGATAATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-176s1c1
Sequence:CCGGCTTGGTGTTCTCAAGCTCCTACTCGAGTAGGAGCTTGAGAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009642
VALIDATED
AGTRAP MISSION shRNA Lentiviral Transduction Particles
angiotensin II receptor-associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009642.3-1291s1c1
Sequence:CCGGCCTCTGAATCTAAGTGACTATCTCGAGATAGTCACTTAGATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-502s1c1
Sequence:CCGGCCTACCAGACAATTGACTCATCTCGAGATGAGTCAATTGTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-505s1c1
Sequence:CCGGACCAGACAATTGACTCATCATCTCGAGATGATGAGTCAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-304s1c1
Sequence:CCGGTCCTGGACATTATCTACATTACTCGAGTAATGTAGATAATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009642.3-176s1c1
Sequence:CCGGCTTGGTGTTCTCAAGCTCCTACTCGAGTAGGAGCTTGAGAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks