EMAIL THIS PAGE TO A FRIEND

AGXT2

alanine--glyoxylate aminotransferase 2

62 Gene Product Result for
Synonyms: AGT2 DAIBAT
UniProtKB ID: Q9BYV1, Q53FB4, Q53FY7, Q53G03, Q5W7Q1
Gene ID:
Human(64902) Summary: The protein encoded by this gene is a class III pyridoxal-phosphate-dependent mitochondrial aminotransferase. It catalyzes the conversion of glyoxylate to glycine using L-alanine as the amino donor. [provided by RefSeq, Dec 2008]
Mouse(268782) alanine-glyoxylate aminotransferase 2
Rat(83784) alanine-glyoxylate aminotransferase 2
sheep(101111660) alanine--glyoxylate aminotransferase 2
Domestic Rabbit(100352336) alanine--glyoxylate aminotransferase 2
naked mole-rat(101714498) alanine--glyoxylate aminotransferase 2
domestic guinea pig(100714301) alanine--glyoxylate aminotransferase 2
Zebrafish(619269) alanine-glyoxylate aminotransferase 2
dog(612589) alanine--glyoxylate aminotransferase 2
chicken(431666) alanine--glyoxylate aminotransferase 2
cow(521553) alanine--glyoxylate aminotransferase 2
domestic cat(101097947) alanine--glyoxylate aminotransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001031851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018941 MISSION® esiRNA esiRNA targeting human AGXT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031900 Rosetta Predictions human pricing
NM_031835 Rosetta Predictions rat pricing
NM_001031851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126294 predicted 778
2 SASI_Hs01_00126295 predicted 873
3 SASI_Hs01_00126296 predicted 1296
4 SASI_Hs02_00359020 predicted 1315
5 SASI_Hs01_00126298 predicted 1111
6 SASI_Hs01_00126299 predicted 518
7 SASI_Hs01_00126300 predicted 1452
8 SASI_Hs02_00359021 predicted 1077
9 SASI_Hs01_00126301 predicted 1234
10 SASI_Hs01_00126302 predicted 1255
11 SASI_Hs01_00126297 predicted 1309
12 SASI_Hs01_00126303 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065984 predicted 1109
2 SASI_Rn01_00065987 predicted 353
3 SASI_Rn02_00265317 predicted 830
4 SASI_Rn01_00065988 predicted 1270
5 SASI_Rn01_00065989 predicted 1636
6 SASI_Rn01_00065990 predicted 1035
7 SASI_Rn02_00265318 predicted 649
8 SASI_Rn01_00065991 predicted 699
9 SASI_Rn01_00065992 predicted 1150
10 SASI_Rn01_00065993 predicted 1624
11 SASI_Rn01_00065985 predicted 1257
12 SASI_Rn01_00065986 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173673 predicted 1197
2 SASI_Mm01_00173674 predicted 290
3 SASI_Mm01_00173675 predicted 884
4 SASI_Mm01_00173676 predicted 560
5 SASI_Mm01_00173677 predicted 1318
6 SASI_Mm01_00173679 predicted 1189
7 SASI_Mm01_00173680 predicted 823
8 SASI_Mm01_00173681 predicted 251
9 SASI_Mm01_00173682 predicted 808
10 SASI_Mm02_00288164 predicted 400
11 SASI_Mm01_00173678 predicted 1425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031900
AGXT2 MISSION shRNA Bacterial Glycerol Stock
alanine--glyoxylate aminotransferase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031900.2-1890s21c1
Sequence:CCGGCCCTTTGCAGTGATTGGTTTACTCGAGTAAACCAATCACTGCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-778s1c1
Sequence:CCGGGCCAAGCTAAAGATCAGTATACTCGAGTATACTGATCTTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1454s1c1
Sequence:CCGGGCCCTCAATGTGCATCACTAACTCGAGTTAGTGATGCACATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1318s1c1
Sequence:CCGGGCATAGAAATGGTGCAGGATACTCGAGTATCCTGCACCATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1179s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTAAACTCGAGTTTAATCACCTCAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-165s1c1
Sequence:CCGGCCTGAAAGATACCAGTCCCTTCTCGAGAAGGGACTGGTATCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031900
AGXT2 MISSION shRNA shRNA Plasmid DNA
alanine--glyoxylate aminotransferase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031900.2-1890s21c1
Sequence:CCGGCCCTTTGCAGTGATTGGTTTACTCGAGTAAACCAATCACTGCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-778s1c1
Sequence:CCGGGCCAAGCTAAAGATCAGTATACTCGAGTATACTGATCTTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1454s1c1
Sequence:CCGGGCCCTCAATGTGCATCACTAACTCGAGTTAGTGATGCACATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1318s1c1
Sequence:CCGGGCATAGAAATGGTGCAGGATACTCGAGTATCCTGCACCATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1179s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTAAACTCGAGTTTAATCACCTCAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-165s1c1
Sequence:CCGGCCTGAAAGATACCAGTCCCTTCTCGAGAAGGGACTGGTATCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031900
AGXT2 MISSION shRNA Lentiviral Transduction Particles
alanine--glyoxylate aminotransferase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031900.2-1890s21c1
Sequence:CCGGCCCTTTGCAGTGATTGGTTTACTCGAGTAAACCAATCACTGCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-778s1c1
Sequence:CCGGGCCAAGCTAAAGATCAGTATACTCGAGTATACTGATCTTTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1454s1c1
Sequence:CCGGGCCCTCAATGTGCATCACTAACTCGAGTTAGTGATGCACATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1318s1c1
Sequence:CCGGGCATAGAAATGGTGCAGGATACTCGAGTATCCTGCACCATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-1179s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTAAACTCGAGTTTAATCACCTCAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031900.1-165s1c1
Sequence:CCGGCCTGAAAGATACCAGTCCCTTCTCGAGAAGGGACTGGTATCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031851
AGXT2 MISSION shRNA Bacterial Glycerol Stock
alanine--glyoxylate aminotransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1363s1c1
Sequence:CCGGCGGGACGAATTTGATATCGTTCTCGAGAACGATATCAAATTCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-633s1c1
Sequence:CCGGCCTGACAAATGTCGGAATCTACTCGAGTAGATTCCGACATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1674s1c1
Sequence:CCGGCCTGTGTACAGAGATGAACTTCTCGAGAAGTTCATCTCTGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1651s1c1
Sequence:CCGGCCATGAGCCTAAAGAACGTCTCTCGAGAGACGTTCTTTAGGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1276s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTGAACTCGAGTTCAATCACCTCAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031851
AGXT2 MISSION shRNA shRNA Plasmid DNA
alanine--glyoxylate aminotransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1363s1c1
Sequence:CCGGCGGGACGAATTTGATATCGTTCTCGAGAACGATATCAAATTCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-633s1c1
Sequence:CCGGCCTGACAAATGTCGGAATCTACTCGAGTAGATTCCGACATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1674s1c1
Sequence:CCGGCCTGTGTACAGAGATGAACTTCTCGAGAAGTTCATCTCTGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1651s1c1
Sequence:CCGGCCATGAGCCTAAAGAACGTCTCTCGAGAGACGTTCTTTAGGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1276s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTGAACTCGAGTTCAATCACCTCAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031851
AGXT2 MISSION shRNA Lentiviral Transduction Particles
alanine--glyoxylate aminotransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1363s1c1
Sequence:CCGGCGGGACGAATTTGATATCGTTCTCGAGAACGATATCAAATTCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-633s1c1
Sequence:CCGGCCTGACAAATGTCGGAATCTACTCGAGTAGATTCCGACATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1674s1c1
Sequence:CCGGCCTGTGTACAGAGATGAACTTCTCGAGAAGTTCATCTCTGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031851.1-1651s1c1
Sequence:CCGGCCATGAGCCTAAAGAACGTCTCTCGAGAGACGTTCTTTAGGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031851.1-1276s1c1
Sequence:CCGGGCTGTGCTTGAGGTGATTGAACTCGAGTTCAATCACCTCAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks