EMAIL THIS PAGE TO A FRIEND

AGXT

alanine-glyoxylate aminotransferase

52 Gene Product Result for
Synonyms: AGT AGT1 AGXT1 PH1 SPAT SPT TLH6
UniProtKB ID: P21549, Q53QU6
Gene ID:
Human(189) Summary: This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]
Mouse(11611) alanine-glyoxylate aminotransferase
Rat(24792) alanine-glyoxylate aminotransferase
chicken(770344) alanine-glyoxylate aminotransferase
dog(607355) alanine-glyoxylate aminotransferase
cow(789572) alanine-glyoxylate aminotransferase
domestic cat(727692) alanine-glyoxylate aminotransferase
naked mole-rat(101709143) alanine-glyoxylate aminotransferase
Domestic Rabbit(100009147) alanine-glyoxylate aminotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000030 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010381 MISSION® esiRNA esiRNA targeting human AGXT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000030 Rosetta Predictions human pricing
NM_030656 Rosetta Predictions rat pricing
NM_016702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153951 predicted 920
2 SASI_Hs01_00153952 predicted 1224
3 SASI_Hs01_00153953 predicted 1078
4 SASI_Hs02_00301701 predicted 479
5 SASI_Hs01_00153955 predicted 768
6 SASI_Hs01_00153957 predicted 1210
7 SASI_Hs01_00153958 predicted 1119
8 SASI_Hs01_00153959 predicted 1083
9 SASI_Hs01_00153960 predicted 1109
10 SASI_Hs02_00301702 predicted 1135
11 SASI_Hs01_00153954 predicted 1361
12 SASI_Hs01_00153956 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079180 predicted 1081
2 SASI_Rn02_00264031 predicted 774
3 SASI_Rn01_00079181 predicted 1114
4 SASI_Rn01_00079182 predicted 295
5 SASI_Rn01_00079183 predicted 827
6 SASI_Rn01_00079184 predicted 1319
7 SASI_Rn01_00079185 predicted 898
8 SASI_Rn01_00079186 predicted 746
9 SASI_Rn01_00079187 predicted 358
10 SASI_Rn01_00079188 predicted 1275
11 SASI_Rn01_00079189 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103612 predicted 206
2 SASI_Mm02_00323371 predicted 1022
3 SASI_Mm01_00103613 predicted 807
4 SASI_Mm01_00103614 predicted 1018
5 SASI_Mm01_00103615 predicted 1170
6 SASI_Mm01_00103616 predicted 769
7 SASI_Mm01_00103617 predicted 524
8 SASI_Mm01_00103618 predicted 270
9 SASI_Mm01_00103620 predicted 992
10 SASI_Mm02_00323372 predicted 372
11 SASI_Mm01_00103619 predicted 1029
12 SASI_Mm01_00103621 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016702
AGXT MISSION shRNA Bacterial Glycerol Stock
alanine-glyoxylate aminotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016702.1-1367s1c1
Sequence:CCGGGCCAGCAAAGATGCTGATGTACTCGAGTACATCAGCATCTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-689s1c1
Sequence:CCGGCCTATCTACATGGACCAACAACTCGAGTTGTTGGTCCATGTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-1261s1c1
Sequence:CCGGCCTGCAGCATTGTCCTAAGAACTCGAGTTCTTAGGACAATGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-882s1c1
Sequence:CCGGAGACCAGAGTAATTCATCATACTCGAGTATGATGAATTACTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-233s1c1
Sequence:CCGGGCGGGAAGTCTGAGAATGATTCTCGAGAATCATTCTCAGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016702
AGXT MISSION shRNA shRNA Plasmid DNA
alanine-glyoxylate aminotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016702.1-1367s1c1
Sequence:CCGGGCCAGCAAAGATGCTGATGTACTCGAGTACATCAGCATCTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-689s1c1
Sequence:CCGGCCTATCTACATGGACCAACAACTCGAGTTGTTGGTCCATGTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-1261s1c1
Sequence:CCGGCCTGCAGCATTGTCCTAAGAACTCGAGTTCTTAGGACAATGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-882s1c1
Sequence:CCGGAGACCAGAGTAATTCATCATACTCGAGTATGATGAATTACTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-233s1c1
Sequence:CCGGGCGGGAAGTCTGAGAATGATTCTCGAGAATCATTCTCAGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016702
AGXT MISSION shRNA Lentiviral Transduction Particles
alanine-glyoxylate aminotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016702.1-1367s1c1
Sequence:CCGGGCCAGCAAAGATGCTGATGTACTCGAGTACATCAGCATCTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-689s1c1
Sequence:CCGGCCTATCTACATGGACCAACAACTCGAGTTGTTGGTCCATGTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-1261s1c1
Sequence:CCGGCCTGCAGCATTGTCCTAAGAACTCGAGTTCTTAGGACAATGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-882s1c1
Sequence:CCGGAGACCAGAGTAATTCATCATACTCGAGTATGATGAATTACTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016702.1-233s1c1
Sequence:CCGGGCGGGAAGTCTGAGAATGATTCTCGAGAATCATTCTCAGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000030
AGXT MISSION shRNA Bacterial Glycerol Stock
alanine-glyoxylate aminotransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-1130s1c1
Sequence:CCGGCAGCTACGTCATAGACCACTTCTCGAGAAGTGGTCTATGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-272s1c1
Sequence:CCGGCAAGGATATGTACCAGATCATCTCGAGATGATCTGGTACATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-833s1c1
Sequence:CCGGCTTCTCCTTCTACCTGGACATCTCGAGATGTCCAGGTAGAAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-892s1c1
Sequence:CCGGCCAGGATGTACCATCACACAACTCGAGTTGTGTGATGGTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-281s1c1
Sequence:CCGGGTACCAGATCATGGACGAGATCTCGAGATCTCGTCCATGATCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-305s21c1
Sequence:CCCGGAAGGCATCCAGTACGTGTTCCTCGAGGAACACGTACTGGATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000030.2-1354s21c1
Sequence:CCGGTGAGGGATCAGGAGCAAACAGCTCGAGCTGTTTGCTCCTGATCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-715s21c1
Sequence:CCGGAGGCATCGACATCCTGTACTCCTCGAGGAGTACAGGATGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000030
AGXT MISSION shRNA shRNA Plasmid DNA
alanine-glyoxylate aminotransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-1130s1c1
Sequence:CCGGCAGCTACGTCATAGACCACTTCTCGAGAAGTGGTCTATGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-272s1c1
Sequence:CCGGCAAGGATATGTACCAGATCATCTCGAGATGATCTGGTACATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-833s1c1
Sequence:CCGGCTTCTCCTTCTACCTGGACATCTCGAGATGTCCAGGTAGAAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-892s1c1
Sequence:CCGGCCAGGATGTACCATCACACAACTCGAGTTGTGTGATGGTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-281s1c1
Sequence:CCGGGTACCAGATCATGGACGAGATCTCGAGATCTCGTCCATGATCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-305s21c1
Sequence:CCCGGAAGGCATCCAGTACGTGTTCCTCGAGGAACACGTACTGGATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000030.2-1354s21c1
Sequence:CCGGTGAGGGATCAGGAGCAAACAGCTCGAGCTGTTTGCTCCTGATCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-715s21c1
Sequence:CCGGAGGCATCGACATCCTGTACTCCTCGAGGAGTACAGGATGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000030
AGXT MISSION shRNA Lentiviral Transduction Particles
alanine-glyoxylate aminotransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-1130s1c1
Sequence:CCGGCAGCTACGTCATAGACCACTTCTCGAGAAGTGGTCTATGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-272s1c1
Sequence:CCGGCAAGGATATGTACCAGATCATCTCGAGATGATCTGGTACATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-833s1c1
Sequence:CCGGCTTCTCCTTCTACCTGGACATCTCGAGATGTCCAGGTAGAAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-892s1c1
Sequence:CCGGCCAGGATGTACCATCACACAACTCGAGTTGTGTGATGGTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000030.1-281s1c1
Sequence:CCGGGTACCAGATCATGGACGAGATCTCGAGATCTCGTCCATGATCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-305s21c1
Sequence:CCCGGAAGGCATCCAGTACGTGTTCCTCGAGGAACACGTACTGGATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000030.2-1354s21c1
Sequence:CCGGTGAGGGATCAGGAGCAAACAGCTCGAGCTGTTTGCTCCTGATCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000030.2-715s21c1
Sequence:CCGGAGGCATCGACATCCTGTACTCCTCGAGGAGTACAGGATGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks