EMAIL THIS PAGE TO A FRIEND

AHCTF1

AT hook containing transcription factor 1

132 Gene Product Result for
Synonyms: ELYS MST108 TMBS62
Gene ID:
Mouse(226747) AT hook containing transcription factor 1
Rat(360886) AT hook containing transcription factor 1
Zebrafish(553494) AT hook containing transcription factor 1
Horse(100054592) AT hook containing transcription factor 1
cow(504716) AT hook containing transcription factor 1
domestic cat(101088452) AT hook containing transcription factor 1
chicken(421484) AT hook containing transcription factor 1
dog(480106) AT hook containing transcription factor 1
sheep(101114886) AT hook containing transcription factor 1
Domestic Rabbit(100345445) AT hook containing transcription factor 1
domestic guinea pig(100727239) AT hook containing transcription factor 1
naked mole-rat(101720319) AT hook containing transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031658 Anti-AHCTF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015446 Rosetta Predictions human pricing
XM_341161 Rosetta Predictions rat pricing
NM_026375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066747 predicted 2975
2 SASI_Hs02_00347835 predicted 825
3 SASI_Hs01_00066750 predicted 3253
4 SASI_Hs01_00066751 predicted 1854
5 SASI_Hs01_00066752 predicted 3960
6 SASI_Hs01_00066753 predicted 2968
7 SASI_Hs01_00066755 predicted 3015
8 SASI_Hs01_00066756 predicted 2002
9 SASI_Hs02_00347836 predicted 1230
10 SASI_Hs02_00347837 predicted 4398
11 SASI_Hs01_00066748 predicted 3679
12 SASI_Hs01_00066749 predicted 4038
13 SASI_Hs01_00066754 predicted 2946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392513 predicted 704
2 SASI_Rn02_00392514 predicted 2042
3 SASI_Rn02_00392515 predicted 4976
4 SASI_Rn02_00392516 predicted 655
5 SASI_Rn02_00392517 predicted 1781
6 SASI_Rn02_00392518 predicted 4400
7 SASI_Rn02_00392519 predicted 5045
8 SASI_Rn02_00392520 predicted 5142
9 SASI_Rn02_00392521 predicted 3951
10 SASI_Rn02_00392522 predicted 2059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330104 predicted 6606
2 SASI_Mm01_00114823 predicted 1955
3 SASI_Mm01_00114824 predicted 3793
4 SASI_Mm01_00114825 predicted 2399
5 SASI_Mm02_00330105 predicted 1305
6 SASI_Mm02_00330106 predicted 2739
7 SASI_Mm02_00330107 predicted 995
8 SASI_Mm01_00114829 predicted 4647
9 SASI_Mm01_00114830 predicted 5936
10 SASI_Mm02_00330108 predicted 5642
11 SASI_Mm01_00114822 predicted 712
12 SASI_Mm01_00114826 predicted 3009
13 SASI_Mm01_00114827 predicted 4396
14 SASI_Mm01_00114828 predicted 6278
15 SASI_Mm01_00114831 predicted 2218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026375
VALIDATED
AHCTF1 MISSION shRNA Bacterial Glycerol Stock
AT hook containing transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-5154s1c1
Sequence:CCGGGCACCTAATATGTTACCGAAACTCGAGTTTCGGTAACATATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-4387s1c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-525s1c1
Sequence:CCGGGCATATAGATTCAGTGGAGTACTCGAGTACTCCACTGAATCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-2403s1c1
Sequence:CCGGCGCTACAACTACCCTGTAATTCTCGAGAATTACAGGGTAGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-4974s1c1
Sequence:CCGGGCAGAGAAACTTGAGTACAATCTCGAGATTGTACTCAAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1608s21c1
Sequence:CCGGGTTTGGCATCAGGGCAAATTTCTCGAGAAATTTGCCCTGATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1050s21c1
Sequence:CCGGCAGCTATCGAGCCTATAATTACTCGAGTAATTATAGGCTCGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-4731s21c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-5487s21c1
Sequence:CCGGGCGACTCTGCAGCACCTAATACTCGAGTATTAGGTGCTGCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-7573s21c1
Sequence:CCGGTACGACTTGATGCGTTTATATCTCGAGATATAAACGCATCAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026375
VALIDATED
AHCTF1 MISSION shRNA shRNA Plasmid DNA
AT hook containing transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-5154s1c1
Sequence:CCGGGCACCTAATATGTTACCGAAACTCGAGTTTCGGTAACATATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-4387s1c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-525s1c1
Sequence:CCGGGCATATAGATTCAGTGGAGTACTCGAGTACTCCACTGAATCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-2403s1c1
Sequence:CCGGCGCTACAACTACCCTGTAATTCTCGAGAATTACAGGGTAGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-4974s1c1
Sequence:CCGGGCAGAGAAACTTGAGTACAATCTCGAGATTGTACTCAAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1608s21c1
Sequence:CCGGGTTTGGCATCAGGGCAAATTTCTCGAGAAATTTGCCCTGATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1050s21c1
Sequence:CCGGCAGCTATCGAGCCTATAATTACTCGAGTAATTATAGGCTCGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-4731s21c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-5487s21c1
Sequence:CCGGGCGACTCTGCAGCACCTAATACTCGAGTATTAGGTGCTGCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-7573s21c1
Sequence:CCGGTACGACTTGATGCGTTTATATCTCGAGATATAAACGCATCAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026375
VALIDATED
AHCTF1 MISSION shRNA Lentiviral Transduction Particles
AT hook containing transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-5154s1c1
Sequence:CCGGGCACCTAATATGTTACCGAAACTCGAGTTTCGGTAACATATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-4387s1c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026375.1-525s1c1
Sequence:CCGGGCATATAGATTCAGTGGAGTACTCGAGTACTCCACTGAATCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-2403s1c1
Sequence:CCGGCGCTACAACTACCCTGTAATTCTCGAGAATTACAGGGTAGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026375.1-4974s1c1
Sequence:CCGGGCAGAGAAACTTGAGTACAATCTCGAGATTGTACTCAAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1608s21c1
Sequence:CCGGGTTTGGCATCAGGGCAAATTTCTCGAGAAATTTGCCCTGATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-1050s21c1
Sequence:CCGGCAGCTATCGAGCCTATAATTACTCGAGTAATTATAGGCTCGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-4731s21c1
Sequence:CCGGCCACTGAACTAACTACTAATTCTCGAGAATTAGTAGTTAGTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-5487s21c1
Sequence:CCGGGCGACTCTGCAGCACCTAATACTCGAGTATTAGGTGCTGCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026375.2-7573s21c1
Sequence:CCGGTACGACTTGATGCGTTTATATCTCGAGATATAAACGCATCAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015446
VALIDATED
AHCTF1 MISSION shRNA Bacterial Glycerol Stock
AT hook containing transcription factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-4662s1c1
Sequence:CCGGGCCCTCCTGATACTCAAGAAACTCGAGTTTCTTGAGTATCAGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015446.1-189s1c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-6768s1c1
Sequence:CCGGCCATAGAAATTCGGCTGATTTCTCGAGAAATCAGCCGAATTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-3221s1c1
Sequence:CCGGCCCAAACCATTATCAGCAGTTCTCGAGAACTGCTGATAATGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015446.3-7882s21c1
Sequence:CCGGGTGTAATGAATGGACTATTAACTCGAGTTAATAGTCCATTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-5785s21c1
Sequence:CCGGTGACAAGCAGCTGCGTATTAACTCGAGTTAATACGCAGCTGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3459s21c1
Sequence:CCGGTGCCCTCAAGTTCGCAATTAACTCGAGTTAATTGCGAACTTGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3205s21c1
Sequence:CCGGGGCAAGCAAAGAACCTATAAACTCGAGTTTATAGGTTCTTTGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-72s21c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015446
VALIDATED
AHCTF1 MISSION shRNA shRNA Plasmid DNA
AT hook containing transcription factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-4662s1c1
Sequence:CCGGGCCCTCCTGATACTCAAGAAACTCGAGTTTCTTGAGTATCAGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015446.1-189s1c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-6768s1c1
Sequence:CCGGCCATAGAAATTCGGCTGATTTCTCGAGAAATCAGCCGAATTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-3221s1c1
Sequence:CCGGCCCAAACCATTATCAGCAGTTCTCGAGAACTGCTGATAATGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015446.3-7882s21c1
Sequence:CCGGGTGTAATGAATGGACTATTAACTCGAGTTAATAGTCCATTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-5785s21c1
Sequence:CCGGTGACAAGCAGCTGCGTATTAACTCGAGTTAATACGCAGCTGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3459s21c1
Sequence:CCGGTGCCCTCAAGTTCGCAATTAACTCGAGTTAATTGCGAACTTGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3205s21c1
Sequence:CCGGGGCAAGCAAAGAACCTATAAACTCGAGTTTATAGGTTCTTTGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-72s21c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015446
VALIDATED
AHCTF1 MISSION shRNA Lentiviral Transduction Particles
AT hook containing transcription factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-4662s1c1
Sequence:CCGGGCCCTCCTGATACTCAAGAAACTCGAGTTTCTTGAGTATCAGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015446.1-189s1c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-6768s1c1
Sequence:CCGGCCATAGAAATTCGGCTGATTTCTCGAGAAATCAGCCGAATTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015446.1-3221s1c1
Sequence:CCGGCCCAAACCATTATCAGCAGTTCTCGAGAACTGCTGATAATGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015446.3-7882s21c1
Sequence:CCGGGTGTAATGAATGGACTATTAACTCGAGTTAATAGTCCATTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-5785s21c1
Sequence:CCGGTGACAAGCAGCTGCGTATTAACTCGAGTTAATACGCAGCTGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3459s21c1
Sequence:CCGGTGCCCTCAAGTTCGCAATTAACTCGAGTTAATTGCGAACTTGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-3205s21c1
Sequence:CCGGGGCAAGCAAAGAACCTATAAACTCGAGTTTATAGGTTCTTTGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015446.3-72s21c1
Sequence:CCGGCCCTTGGAGAAGACGAAATAACTCGAGTTATTTCGTCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks