EMAIL THIS PAGE TO A FRIEND

AHCY

adenosylhomocysteinase

111 Gene Product Result for
Synonyms: SAHH adoHcyase
UniProtKB ID: P23526, A8K307, B3KUN3, E1P5P2, F5H737, Q96A36
Gene ID:
Human(191) Summary: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(269378) S-adenosylhomocysteine hydrolase
Rat(29443) adenosylhomocysteinase
Zebrafish(387530) S-adenosylhomocysteine hydrolase
chicken(419146) adenosylhomocysteinase
dog(477198) adenosylhomocysteinase
cow(508158) adenosylhomocysteinase
domestic cat(101086386) adenosylhomocysteinase
naked mole-rat(101712599) adenosylhomocysteinase
domestic guinea pig(100723355) adenosylhomocysteinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108644 Anti-AHCY affinity isolated antibody horse, mouse, pig, zebrafish, rat, human, bovine, canine, bovine
western blot pricing
A8983 Anti-AHCY (321-335) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A8858 Anti-AHCY (36-50) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405439 Anti-AHCY antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412120 ANTI-AHCY antibody produced in mouse clone M2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412121 ANTI-AHCY antibody produced in mouse clone 2F11-1D10, ascites fluid, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2100075 Anti-AHCY antibody produced in rabbit affinity isolated antibody pig, canine, human, mouse, rat, horse, bovine, zebrafish, rabbit
western blot pricing
HPA044675 Anti-AHCY antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA041225 Anti-AHCY antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2106938 Anti-AHCY antibody produced in rabbit affinity isolated antibody human, mouse, horse, guinea pig, rabbit
ELISA, western blot pricing
SAB1306296 ANTI-S ADENOSYLHOMOCYSTEINE HYDROLASE (ACHY)(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306295 ANTI-S ADENOSYLHOMOCYSTEINE HYDROLASE (ACHY)(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0000191M8 Monoclonal Anti-AHCY antibody produced in mouse clone M1, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing
SAB1403534 Monoclonal Anti-AHCY antibody produced in mouse clone 4H2, ascites fluid human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A5762 Adenine 9-β-D-arabinofuranoside ≥99% mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000687 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154411 MISSION® esiRNA esiRNA human AHCY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000687 Rosetta Predictions human pricing
NM_017201 Rosetta Predictions rat pricing
NM_016661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081284 predicted 1401
2 SASI_Hs01_00081285 predicted 1419
3 SASI_Hs01_00081287 predicted 1417
4 SASI_Hs01_00081289 predicted 934
5 SASI_Hs01_00081290 predicted 940
6 SASI_Hs01_00081291 predicted 1511
7 SASI_Hs02_00303088 predicted 381
8 SASI_Hs01_00081292 predicted 645
9 SASI_Hs01_00081293 predicted 910
10 SASI_Hs02_00303089 predicted 527
11 SASI_Hs01_00081286 predicted 819
12 SASI_Hs01_00081288 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093689 predicted 623
2 SASI_Rn01_00093690 predicted 1397
3 SASI_Rn01_00093691 predicted 620
4 SASI_Rn01_00093692 predicted 1401
5 SASI_Rn01_00093693 predicted 1404
6 SASI_Rn01_00093694 predicted 1411
7 SASI_Rn01_00093695 predicted 815
8 SASI_Rn01_00093696 predicted 1106
9 SASI_Rn01_00093697 predicted 1380
10 SASI_Rn01_00093698 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037745 predicted 1115
2 SASI_Mm02_00323265 predicted 517
3 SASI_Mm01_00037743 predicted 743
4 SASI_Mm01_00037742 predicted 1392
5 SASI_Mm02_00323266 predicted 366
6 SASI_Mm02_00323267 predicted 43
7 SASI_Mm01_00037744 predicted 830
8 SASI_Mm01_00037746 predicted 806
9 SASI_Mm01_00037747 predicted 595
10 SASI_Mm01_00037748 predicted 439
11 SASI_Mm01_00037749 predicted 433
12 SASI_Mm01_00037750 predicted 830
13 SASI_Mm01_00037751 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016661
VALIDATED
AHCY MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-425s21c1
Sequence:CCGGGATGGTGGTGACCTTACTAACCTCGAGGTTAGTAAGGTCACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-978s21c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-95s21c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1150s21c1
Sequence:CCGGGTGGACCCACCCAGATAAATACTCGAGTATTTATCTGGGTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1399s21c1
Sequence:CCGGGAGCAAATGTCACCAACTTTGCTCGAGCAAAGTTGGTGACATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016661.1-1598s1c1
Sequence:CCGGCCATGCACCTTATCATTGATACTCGAGTATCAATGATAAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-716s1c1
Sequence:CCGGCCGAGTCATCATCACCGAGATCTCGAGATCTCGGTGATGATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-531s1c1
Sequence:CCGGCCTGCCATCAATGTCAACGATCTCGAGATCGTTGACATTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-66s1c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-949s1c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016661
VALIDATED
AHCY MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-425s21c1
Sequence:CCGGGATGGTGGTGACCTTACTAACCTCGAGGTTAGTAAGGTCACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-978s21c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-95s21c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1150s21c1
Sequence:CCGGGTGGACCCACCCAGATAAATACTCGAGTATTTATCTGGGTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1399s21c1
Sequence:CCGGGAGCAAATGTCACCAACTTTGCTCGAGCAAAGTTGGTGACATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016661.1-1598s1c1
Sequence:CCGGCCATGCACCTTATCATTGATACTCGAGTATCAATGATAAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-716s1c1
Sequence:CCGGCCGAGTCATCATCACCGAGATCTCGAGATCTCGGTGATGATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-531s1c1
Sequence:CCGGCCTGCCATCAATGTCAACGATCTCGAGATCGTTGACATTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-66s1c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-949s1c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016661
VALIDATED
AHCY MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-425s21c1
Sequence:CCGGGATGGTGGTGACCTTACTAACCTCGAGGTTAGTAAGGTCACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-978s21c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-95s21c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1150s21c1
Sequence:CCGGGTGGACCCACCCAGATAAATACTCGAGTATTTATCTGGGTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016661.2-1399s21c1
Sequence:CCGGGAGCAAATGTCACCAACTTTGCTCGAGCAAAGTTGGTGACATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016661.1-1598s1c1
Sequence:CCGGCCATGCACCTTATCATTGATACTCGAGTATCAATGATAAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-716s1c1
Sequence:CCGGCCGAGTCATCATCACCGAGATCTCGAGATCTCGGTGATGATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-531s1c1
Sequence:CCGGCCTGCCATCAATGTCAACGATCTCGAGATCGTTGACATTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-66s1c1
Sequence:CCGGGCTCTGGATATAGCTGAGAATCTCGAGATTCTCAGCTATATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016661.1-949s1c1
Sequence:CCGGCGGTGGAGAAAGTGAACATCACTCGAGTGATGTTCACTTTCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000687
VALIDATED
AHCY MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-925s21c1
Sequence:GTACCGGATGCCATTGTGTGTAACATTGCTCGAGCAATGTTACACACAATGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-844s21c1
Sequence:CCGGGTCAGGAGGGCAACATCTTTGCTCGAGCAAAGATGTTGCCCTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-595s21c1
Sequence:CCGGCCGTCACCAAGAGCAAGTTTGCTCGAGCAAACTTGCTCTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000687.1-565s21c1
Sequence:CCGGTCAAGGTGCCTGCCATCAATGCTCGAGCATTGATGGCAGGCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-1411s21c1
Sequence:CCGGGAGCTAATGGCACCAACTTTGCTCGAGCAAAGTTGGTGCCATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-530s1c1
Sequence:CCGGCCACAACCTCTACAAGATGATCTCGAGATCATCTTGTAGAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-1118s1c1
Sequence:CCGGGATGAGTAACTCCTTCACCAACTCGAGTTGGTGAAGGAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-660s1c1
Sequence:CCGGCGGGCCACAGATGTGATGATTCTCGAGAATCATCACATCTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-933s1c1
Sequence:CCGGGTGTGTAACATTGGACACTTTCTCGAGAAAGTGTCCAATGTTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-872s1c1
Sequence:CCGGCACAGGCTGTATTGACATCATCTCGAGATGATGTCAATACAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000687
VALIDATED
AHCY MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-925s21c1
Sequence:GTACCGGATGCCATTGTGTGTAACATTGCTCGAGCAATGTTACACACAATGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-844s21c1
Sequence:CCGGGTCAGGAGGGCAACATCTTTGCTCGAGCAAAGATGTTGCCCTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-595s21c1
Sequence:CCGGCCGTCACCAAGAGCAAGTTTGCTCGAGCAAACTTGCTCTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000687.1-565s21c1
Sequence:CCGGTCAAGGTGCCTGCCATCAATGCTCGAGCATTGATGGCAGGCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-1411s21c1
Sequence:CCGGGAGCTAATGGCACCAACTTTGCTCGAGCAAAGTTGGTGCCATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-530s1c1
Sequence:CCGGCCACAACCTCTACAAGATGATCTCGAGATCATCTTGTAGAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-1118s1c1
Sequence:CCGGGATGAGTAACTCCTTCACCAACTCGAGTTGGTGAAGGAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-660s1c1
Sequence:CCGGCGGGCCACAGATGTGATGATTCTCGAGAATCATCACATCTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-933s1c1
Sequence:CCGGGTGTGTAACATTGGACACTTTCTCGAGAAAGTGTCCAATGTTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-872s1c1
Sequence:CCGGCACAGGCTGTATTGACATCATCTCGAGATGATGTCAATACAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000687
VALIDATED
AHCY MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-925s21c1
Sequence:GTACCGGATGCCATTGTGTGTAACATTGCTCGAGCAATGTTACACACAATGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-844s21c1
Sequence:CCGGGTCAGGAGGGCAACATCTTTGCTCGAGCAAAGATGTTGCCCTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-595s21c1
Sequence:CCGGCCGTCACCAAGAGCAAGTTTGCTCGAGCAAACTTGCTCTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000687.1-565s21c1
Sequence:CCGGTCAAGGTGCCTGCCATCAATGCTCGAGCATTGATGGCAGGCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000687.1-1411s21c1
Sequence:CCGGGAGCTAATGGCACCAACTTTGCTCGAGCAAAGTTGGTGCCATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-530s1c1
Sequence:CCGGCCACAACCTCTACAAGATGATCTCGAGATCATCTTGTAGAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-1118s1c1
Sequence:CCGGGATGAGTAACTCCTTCACCAACTCGAGTTGGTGAAGGAGTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-660s1c1
Sequence:CCGGCGGGCCACAGATGTGATGATTCTCGAGAATCATCACATCTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-933s1c1
Sequence:CCGGGTGTGTAACATTGGACACTTTCTCGAGAAAGTGTCCAATGTTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000687.1-872s1c1
Sequence:CCGGCACAGGCTGTATTGACATCATCTCGAGATGATGTCAATACAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks