EMAIL THIS PAGE TO A FRIEND

AHCYL1

adenosylhomocysteinase-like 1

167 Gene Product Result for
Synonyms: DCAL IRBIT PRO0233 XPVKONA
Gene ID:
Human(10768) Summary: The protein encoded by this gene interacts with inositol 1,4,5-trisphosphate receptor, type 1 and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(229709) S-adenosylhomocysteine hydrolase-like 1
Rat(362013) adenosylhomocysteinase-like 1
Zebrafish(798918) S-adenosylhomocysteine hydrolase-like 1
cow(505511) adenosylhomocysteinase-like 1
Horse(100058372) adenosylhomocysteinase-like 1
domestic cat(101080313) adenosylhomocysteinase-like 1
dog(611790) adenosylhomocysteinase-like 1
chicken(419803) adenosylhomocysteinase-like 1
naked mole-rat(101710960) adenosylhomocysteinase-like 1
domestic guinea pig(100733369) adenosylhomocysteinase-like 1
sheep(101109660) adenosylhomocysteinase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006621 Rosetta Predictions human pricing
NM_001108561 Rosetta Predictions rat pricing
NM_145542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135600 predicted 898
2 SASI_Hs01_00135601 predicted 1281
3 SASI_Hs01_00135602 predicted 1795
4 SASI_Hs01_00135603 predicted 1191
5 SASI_Hs01_00135604 predicted 644
6 SASI_Hs01_00135605 predicted 1688
7 SASI_Hs02_00341962 predicted 1034
8 SASI_Hs02_00341963 predicted 994
9 SASI_Hs01_00135606 predicted 1741
10 SASI_Hs01_00135607 predicted 839
11 SASI_Hs01_00135608 predicted 710
12 SASI_Hs01_00135609 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239849 predicted 277
2 SASI_Rn02_00239850 predicted 903
3 SASI_Rn02_00239851 predicted 621
4 SASI_Rn02_00239852 predicted 1247
5 SASI_Rn02_00239853 predicted 990
6 SASI_Rn02_00239854 predicted 1230
7 SASI_Rn02_00239855 predicted 384
8 SASI_Rn02_00239856 predicted 345
9 SASI_Rn02_00239857 predicted 605
10 SASI_Rn02_00239858 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103831 predicted 740
2 SASI_Mm02_00341026 predicted 605
3 SASI_Mm01_00103832 predicted 894
4 SASI_Mm01_00103833 predicted 548
5 SASI_Mm01_00103835 predicted 538
6 SASI_Mm02_00341027 predicted 1622
7 SASI_Mm01_00103836 predicted 668
8 SASI_Mm02_00341028 predicted 623
9 SASI_Mm01_00103838 predicted 1366
10 SASI_Mm01_00103839 predicted 1051
11 SASI_Mm01_00103834 predicted 1488
12 SASI_Mm01_00103837 predicted 849
13 SASI_Mm01_00103840 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006621
VALIDATED
AHCYL1 MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-671s1c1
Sequence:CCGGCAGCAGCAATTTCTGTGTGAACTCGAGTTCACACAGAAATTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1461s1c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006621.3-1860s1c1
Sequence:CCGGCCATCATTTGATGCCCACCTTCTCGAGAAGGTGGGCATCAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1761s1c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1284s1c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1760s21c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1460s21c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-2309s21c1
Sequence:CCGGCAATGTCTAAATCGCCTTAAACTCGAGTTTAAGGCGATTTAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006621.4-1682s21c1
Sequence:CCGGGAGGGTCGTCTACTCAATTTGCTCGAGCAAATTGAGTAGACGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1283s21c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006621
VALIDATED
AHCYL1 MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-671s1c1
Sequence:CCGGCAGCAGCAATTTCTGTGTGAACTCGAGTTCACACAGAAATTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1461s1c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006621.3-1860s1c1
Sequence:CCGGCCATCATTTGATGCCCACCTTCTCGAGAAGGTGGGCATCAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1761s1c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1284s1c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1760s21c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1460s21c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-2309s21c1
Sequence:CCGGCAATGTCTAAATCGCCTTAAACTCGAGTTTAAGGCGATTTAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006621.4-1682s21c1
Sequence:CCGGGAGGGTCGTCTACTCAATTTGCTCGAGCAAATTGAGTAGACGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1283s21c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006621
VALIDATED
AHCYL1 MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-671s1c1
Sequence:CCGGCAGCAGCAATTTCTGTGTGAACTCGAGTTCACACAGAAATTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1461s1c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006621.3-1860s1c1
Sequence:CCGGCCATCATTTGATGCCCACCTTCTCGAGAAGGTGGGCATCAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1761s1c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006621.3-1284s1c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1760s21c1
Sequence:CCGGGCACTGATAGAACTCTATAATCTCGAGATTATAGAGTTCTATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1460s21c1
Sequence:CCGGCGGCAAGTCGATGTCGTAATACTCGAGTATTACGACATCGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-2309s21c1
Sequence:CCGGCAATGTCTAAATCGCCTTAAACTCGAGTTTAAGGCGATTTAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006621.4-1682s21c1
Sequence:CCGGGAGGGTCGTCTACTCAATTTGCTCGAGCAAATTGAGTAGACGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006621.4-1283s21c1
Sequence:CCGGGATGTGATGTTTGGTGGGAAACTCGAGTTTCCCACCAAACATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145542
VALIDATED
AHCYL1 MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-2068s1c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145542.2-1685s1c1
Sequence:CCGGCCTAAGAAGATGGATGAATATCTCGAGATATTCATCCATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-763s1c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-382s1c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-617s1c1
Sequence:CCGGGCTCTGATTTCACTCAGGAAACTCGAGTTTCCTGAGTGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-736s21c1
Sequence:CCGGGGCCCAGACAGCGGTATTAATCTCGAGATTAATACCGCTGTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-421s21c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-802s21c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-988s21c1
Sequence:CCGGGAAGTATCCAAACGTGTTTAACTCGAGTTAAACACGTTTGGATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-2107s21c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145542
VALIDATED
AHCYL1 MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-2068s1c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145542.2-1685s1c1
Sequence:CCGGCCTAAGAAGATGGATGAATATCTCGAGATATTCATCCATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-763s1c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-382s1c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-617s1c1
Sequence:CCGGGCTCTGATTTCACTCAGGAAACTCGAGTTTCCTGAGTGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-736s21c1
Sequence:CCGGGGCCCAGACAGCGGTATTAATCTCGAGATTAATACCGCTGTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-421s21c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-802s21c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-988s21c1
Sequence:CCGGGAAGTATCCAAACGTGTTTAACTCGAGTTAAACACGTTTGGATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-2107s21c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145542
VALIDATED
AHCYL1 MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-2068s1c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145542.2-1685s1c1
Sequence:CCGGCCTAAGAAGATGGATGAATATCTCGAGATATTCATCCATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-763s1c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-382s1c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145542.2-617s1c1
Sequence:CCGGGCTCTGATTTCACTCAGGAAACTCGAGTTTCCTGAGTGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-736s21c1
Sequence:CCGGGGCCCAGACAGCGGTATTAATCTCGAGATTAATACCGCTGTCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-421s21c1
Sequence:CCGGGTTCACCAAATTCCCTACTAACTCGAGTTAGTAGGGAATTTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-802s21c1
Sequence:CCGGCAACATCTATTCAACTCAGAACTCGAGTTCTGAGTTGAATAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145542.3-988s21c1
Sequence:CCGGGAAGTATCCAAACGTGTTTAACTCGAGTTAAACACGTTTGGATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145542.3-2107s21c1
Sequence:CCGGGCCCAGAAAGTTGATTCTTTACTCGAGTAAAGAATCAACTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks