EMAIL THIS PAGE TO A FRIEND

AHCYL2

adenosylhomocysteinase-like 2

159 Gene Product Result for
Synonyms: ADOHCYASE3
UniProtKB ID: Q96HN2, B4DIZ5, D9N155, O94917
Gene ID:
Human(23382) Summary: The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(74340) S-adenosylhomocysteine hydrolase-like 2
Rat(312192) adenosylhomocysteinase-like 2
sheep(101114101) adenosylhomocysteinase-like 2
domestic guinea pig(100719804) adenosylhomocysteinase-like 2
naked mole-rat(101707881) adenosylhomocysteinase-like 2
Zebrafish(394240) S-adenosylhomocysteine hydrolase-like 2
dog(475197) adenosylhomocysteinase-like 2
chicken(416675) adenosylhomocysteinase-like 2
cow(532836) adenosylhomocysteinase-like 2
Horse(100071835) adenosylhomocysteinase-like 2
domestic cat(101085195) adenosylhomocysteinase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015328 Rosetta Predictions human pricing
XM_001062287 Rosetta Predictions rat pricing
XM_231564 Rosetta Predictions rat pricing
NM_021414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059794 predicted 1162
2 SASI_Hs02_00347619 predicted 1875
3 SASI_Hs01_00059795 predicted 1868
4 SASI_Hs01_00059796 predicted 1655
5 SASI_Hs01_00059797 predicted 1340
6 SASI_Hs01_00059799 predicted 1860
7 SASI_Hs01_00059800 predicted 1716
8 SASI_Hs01_00059801 predicted 1294
9 SASI_Hs01_00059802 predicted 827
10 SASI_Hs02_00347620 predicted 1466
11 SASI_Hs01_00059798 predicted 1918
12 SASI_Hs01_00059803 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302946 predicted 1522
2 SASI_Rn02_00302947 predicted 825
3 SASI_Rn02_00302948 predicted 1214
4 SASI_Rn02_00302949 predicted 1059
5 SASI_Rn02_00302950 predicted 1413
6 SASI_Rn02_00302951 predicted 700
7 SASI_Rn02_00302952 predicted 790
8 SASI_Rn02_00302953 predicted 484
9 SASI_Rn02_00302954 predicted 802
10 SASI_Rn02_00302955 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386841 predicted 1973
2 SASI_Rn02_00386842 predicted 1263
3 SASI_Rn02_00386843 predicted 1665
4 SASI_Rn02_00386844 predicted 1504
5 SASI_Rn02_00386845 predicted 1852
6 SASI_Rn02_00386846 predicted 1233
7 SASI_Rn02_00386847 predicted 934
8 SASI_Rn02_00386848 predicted 1247
9 SASI_Rn02_00386849 predicted 2009
10 SASI_Rn02_00386850 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159527 predicted 1831
2 SASI_Mm01_00159528 predicted 1295
3 SASI_Mm01_00159529 predicted 1121
4 SASI_Mm01_00159530 predicted 1163
5 SASI_Mm01_00159531 predicted 1832
6 SASI_Mm01_00159532 predicted 1006
7 SASI_Mm01_00159533 predicted 997
8 SASI_Mm01_00159534 predicted 1824
9 SASI_Mm01_00159535 predicted 603
10 SASI_Mm01_00159536 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021414
VALIDATED
AHCYL2 MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021414.3-3927s1c1
Sequence:CCGGGCCTCATAATTGGATCTCTTTCTCGAGAAAGAGATCCAATTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1647s1c1
Sequence:CCGGGCCTTGATAGAACTTTACAATCTCGAGATTGTAAAGTTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1826s1c1
Sequence:CCGGGCCTAACTACTACAGGTATTACTCGAGTAATACCTGTAGTAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-578s1c1
Sequence:CCGGGAACATCAAACAAGCGGAGTTCTCGAGAACTCCGCTTGTTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-648s1c1
Sequence:CCGGGCTTTAAGGAAGAGAGCCCAACTCGAGTTGGGCTCTCTTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021414
VALIDATED
AHCYL2 MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021414.3-3927s1c1
Sequence:CCGGGCCTCATAATTGGATCTCTTTCTCGAGAAAGAGATCCAATTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1647s1c1
Sequence:CCGGGCCTTGATAGAACTTTACAATCTCGAGATTGTAAAGTTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1826s1c1
Sequence:CCGGGCCTAACTACTACAGGTATTACTCGAGTAATACCTGTAGTAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-578s1c1
Sequence:CCGGGAACATCAAACAAGCGGAGTTCTCGAGAACTCCGCTTGTTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-648s1c1
Sequence:CCGGGCTTTAAGGAAGAGAGCCCAACTCGAGTTGGGCTCTCTTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021414
VALIDATED
AHCYL2 MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021414.3-3927s1c1
Sequence:CCGGGCCTCATAATTGGATCTCTTTCTCGAGAAAGAGATCCAATTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1647s1c1
Sequence:CCGGGCCTTGATAGAACTTTACAATCTCGAGATTGTAAAGTTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021414.3-1826s1c1
Sequence:CCGGGCCTAACTACTACAGGTATTACTCGAGTAATACCTGTAGTAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-578s1c1
Sequence:CCGGGAACATCAAACAAGCGGAGTTCTCGAGAACTCCGCTTGTTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021414.3-648s1c1
Sequence:CCGGGCTTTAAGGAAGAGAGCCCAACTCGAGTTGGGCTCTCTTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015328
VALIDATED
AHCYL2 MISSION shRNA Bacterial Glycerol Stock
adenosylhomocysteinase-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-964s1c1
Sequence:CCGGCCAAACATGATCTTGGATGATCTCGAGATCATCCAAGATCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015328.1-1690s1c1
Sequence:CCGGGCCTTGATAGAGCTTTACAATCTCGAGATTGTAAAGCTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-634s1c1
Sequence:CCGGGCAGAGTTTGGACGAAGAGAACTCGAGTTCTCTTCGTCCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-862s1c1
Sequence:CCGGGCTCTAGCAGAAAGTGGATTTCTCGAGAAATCCACTTTCTGCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-1455s1c1
Sequence:CCGGCCGTATGAAGAATAGCTGCATCTCGAGATGCAGCTATTCTTCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015328
VALIDATED
AHCYL2 MISSION shRNA shRNA Plasmid DNA
adenosylhomocysteinase-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-964s1c1
Sequence:CCGGCCAAACATGATCTTGGATGATCTCGAGATCATCCAAGATCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015328.1-1690s1c1
Sequence:CCGGGCCTTGATAGAGCTTTACAATCTCGAGATTGTAAAGCTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-634s1c1
Sequence:CCGGGCAGAGTTTGGACGAAGAGAACTCGAGTTCTCTTCGTCCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-862s1c1
Sequence:CCGGGCTCTAGCAGAAAGTGGATTTCTCGAGAAATCCACTTTCTGCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-1455s1c1
Sequence:CCGGCCGTATGAAGAATAGCTGCATCTCGAGATGCAGCTATTCTTCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015328
VALIDATED
AHCYL2 MISSION shRNA Lentiviral Transduction Particles
adenosylhomocysteinase-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-964s1c1
Sequence:CCGGCCAAACATGATCTTGGATGATCTCGAGATCATCCAAGATCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015328.1-1690s1c1
Sequence:CCGGGCCTTGATAGAGCTTTACAATCTCGAGATTGTAAAGCTCTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-634s1c1
Sequence:CCGGGCAGAGTTTGGACGAAGAGAACTCGAGTTCTCTTCGTCCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-862s1c1
Sequence:CCGGGCTCTAGCAGAAAGTGGATTTCTCGAGAAATCCACTTTCTGCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015328.1-1455s1c1
Sequence:CCGGCCGTATGAAGAATAGCTGCATCTCGAGATGCAGCTATTCTTCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks