EMAIL THIS PAGE TO A FRIEND

AHDC1

AT hook, DNA binding motif, containing 1

65 Gene Product Result for
Synonyms: CL23945 DJ159A19.3 RP1-159A19.1
UniProtKB ID: Q5TGY3, Q5TGY4, Q6PJK1, Q6ZUQ6, Q99769, Q9NUF5
Gene ID:
Mouse(230793) AT hook, DNA binding motif, containing 1
Rat(362617) AT hook, DNA binding motif, containing 1
Zebrafish(100536210) AT hook, DNA binding motif, containing 1
cow(522105) AT hook, DNA binding motif, containing 1
domestic cat(101083528) AT hook, DNA binding motif, containing 1
dog(487342) AT hook, DNA binding motif, containing 1
chicken(431168) AT hook, DNA binding motif, containing 1
naked mole-rat(101702198) AT hook, DNA binding motif, containing 1
domestic guinea pig(100722997) AT hook, DNA binding motif, containing 1
sheep(101112709) AT hook, DNA binding motif, containing 1
Domestic Rabbit(100342814) AT hook, DNA binding motif, containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001571 MISSION® esiRNA esiRNA targeting human AHDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029882 Rosetta Predictions human pricing
NM_001134956 Rosetta Predictions rat pricing
XR_008178 Rosetta Predictions rat pricing
NM_146155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307563 predicted 5501
2 SASI_Hs01_00106439 predicted 2784
3 SASI_Hs01_00106440 predicted 4891
4 SASI_Hs01_00106441 predicted 5080
5 SASI_Hs01_00106442 predicted 1296
6 SASI_Hs01_00106443 predicted 1310
7 SASI_Hs01_00106444 predicted 4617
8 SASI_Hs01_00106445 predicted 4683
9 SASI_Hs02_00307564 predicted 3742
10 SASI_Hs01_00106446 predicted 4442
11 SASI_Hs01_00106438 predicted 2066
12 SASI_Hs01_00106447 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259064 predicted 3946
2 SASI_Rn02_00259065 predicted 4248
3 SASI_Rn02_00259066 predicted 2211
4 SASI_Rn02_00259067 predicted 3968
5 SASI_Rn02_00259068 predicted 1321
6 SASI_Rn02_00259069 predicted 1335
7 SASI_Rn02_00259070 predicted 3945
8 SASI_Rn02_00259071 predicted 3998
9 SASI_Rn02_00259072 predicted 2785
10 SASI_Rn02_00259073 predicted 4602
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166779 predicted 3862
2 SASI_Rn01_00166781 predicted 4158
3 SASI_Rn01_00166782 predicted 2121
4 SASI_Rn01_00166783 predicted 3886
5 SASI_Rn01_00166784 predicted 1239
6 SASI_Rn02_00416412 predicted 1251
7 SASI_Rn02_00416413 predicted 3866
8 SASI_Rn01_00166785 predicted 3913
9 SASI_Rn01_00166787 predicted 4511
10 SASI_Rn02_00416414 predicted 2126
11 SASI_Rn01_00166780 predicted 4705
12 SASI_Rn01_00166786 predicted 2713
13 SASI_Rn01_00166788 predicted 2742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341843 predicted 4294
2 SASI_Mm01_00053397 predicted 3990
3 SASI_Mm01_00053398 predicted 2102
4 SASI_Mm01_00053399 predicted 2455
5 SASI_Mm01_00053400 predicted 2252
6 SASI_Mm01_00053401 predicted 3994
7 SASI_Mm01_00053402 predicted 4042
8 SASI_Mm01_00053403 predicted 1482
9 SASI_Mm01_00053404 predicted 1602
10 SASI_Mm01_00053406 predicted 1134
11 SASI_Mm01_00053405 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029882
AHDC1 MISSION shRNA Bacterial Glycerol Stock
AT hook, DNA binding motif, containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-3966s1c1
Sequence:CCGGGCCTTTAGTCAGCTCTACAATCTCGAGATTGTAGAGCTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-5288s1c1
Sequence:CCGGCTACAGGTACCCAGGCTTTATCTCGAGATAAAGCCTGGGTACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-4718s1c1
Sequence:CCGGCGAGCTTGATGGCAAGCATTTCTCGAGAAATGCTTGCCATCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029882.2-6275s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4337s21c1
Sequence:CCGGCCTTTAGTCAGCTCTACAATCCTCGAGGATTGTAGAGCTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4901s21c1
Sequence:CCGGACCTCGGCCTGGACTACTATACTCGAGTATAGTAGTCCAGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-2575s21c1
Sequence:CCGGCCCGGTGAGATGCCCATTATTCTCGAGAATAATGGGCATCTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-3515s21c1
Sequence:CCGGCCTCCGATCTCTTGGACTTTGCTCGAGCAAAGTCCAAGAGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029882
AHDC1 MISSION shRNA shRNA Plasmid DNA
AT hook, DNA binding motif, containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-3966s1c1
Sequence:CCGGGCCTTTAGTCAGCTCTACAATCTCGAGATTGTAGAGCTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-5288s1c1
Sequence:CCGGCTACAGGTACCCAGGCTTTATCTCGAGATAAAGCCTGGGTACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-4718s1c1
Sequence:CCGGCGAGCTTGATGGCAAGCATTTCTCGAGAAATGCTTGCCATCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029882.2-6275s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4337s21c1
Sequence:CCGGCCTTTAGTCAGCTCTACAATCCTCGAGGATTGTAGAGCTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4901s21c1
Sequence:CCGGACCTCGGCCTGGACTACTATACTCGAGTATAGTAGTCCAGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-2575s21c1
Sequence:CCGGCCCGGTGAGATGCCCATTATTCTCGAGAATAATGGGCATCTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-3515s21c1
Sequence:CCGGCCTCCGATCTCTTGGACTTTGCTCGAGCAAAGTCCAAGAGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029882
AHDC1 MISSION shRNA Lentiviral Transduction Particles
AT hook, DNA binding motif, containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-3966s1c1
Sequence:CCGGGCCTTTAGTCAGCTCTACAATCTCGAGATTGTAGAGCTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-5288s1c1
Sequence:CCGGCTACAGGTACCCAGGCTTTATCTCGAGATAAAGCCTGGGTACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029882.1-4718s1c1
Sequence:CCGGCGAGCTTGATGGCAAGCATTTCTCGAGAAATGCTTGCCATCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029882.2-6275s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4337s21c1
Sequence:CCGGCCTTTAGTCAGCTCTACAATCCTCGAGGATTGTAGAGCTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-4901s21c1
Sequence:CCGGACCTCGGCCTGGACTACTATACTCGAGTATAGTAGTCCAGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-2575s21c1
Sequence:CCGGCCCGGTGAGATGCCCATTATTCTCGAGAATAATGGGCATCTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029882.2-3515s21c1
Sequence:CCGGCCTCCGATCTCTTGGACTTTGCTCGAGCAAAGTCCAAGAGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146155
AHDC1 MISSION shRNA Bacterial Glycerol Stock
AT hook, DNA binding motif, containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2102s1c1
Sequence:CCGGCCACGTACAAAGTTTCATCCTCTCGAGAGGATGAAACTTTGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2444s1c1
Sequence:CCGGCCAATGACAGTAAGGCTGAATCTCGAGATTCAGCCTTACTGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146155.3-5925s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-3137s21c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5313s21c1
Sequence:CCGGTACAGGTATCCAGGCTTTATGCTCGAGCATAAAGCCTGGATACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-1595s21c1
Sequence:CCGGCCTAGATACCCTACCTGATTCCTCGAGGAATCAGGTAGGGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5398s21c1
Sequence:CCGGCTCACCCTGAGGACACATTTACTCGAGTAAATGTGTCCTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.3-3137s1c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146155
AHDC1 MISSION shRNA shRNA Plasmid DNA
AT hook, DNA binding motif, containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2102s1c1
Sequence:CCGGCCACGTACAAAGTTTCATCCTCTCGAGAGGATGAAACTTTGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2444s1c1
Sequence:CCGGCCAATGACAGTAAGGCTGAATCTCGAGATTCAGCCTTACTGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146155.3-5925s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-3137s21c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5313s21c1
Sequence:CCGGTACAGGTATCCAGGCTTTATGCTCGAGCATAAAGCCTGGATACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-1595s21c1
Sequence:CCGGCCTAGATACCCTACCTGATTCCTCGAGGAATCAGGTAGGGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5398s21c1
Sequence:CCGGCTCACCCTGAGGACACATTTACTCGAGTAAATGTGTCCTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.3-3137s1c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146155
AHDC1 MISSION shRNA Lentiviral Transduction Particles
AT hook, DNA binding motif, containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2102s1c1
Sequence:CCGGCCACGTACAAAGTTTCATCCTCTCGAGAGGATGAAACTTTGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.2-2444s1c1
Sequence:CCGGCCAATGACAGTAAGGCTGAATCTCGAGATTCAGCCTTACTGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146155.3-5925s21c1
Sequence:CCGGTGGTCCCGTGGTGTGCAAATTCTCGAGAATTTGCACACCACGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-3137s21c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5313s21c1
Sequence:CCGGTACAGGTATCCAGGCTTTATGCTCGAGCATAAAGCCTGGATACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-1595s21c1
Sequence:CCGGCCTAGATACCCTACCTGATTCCTCGAGGAATCAGGTAGGGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146155.3-5398s21c1
Sequence:CCGGCTCACCCTGAGGACACATTTACTCGAGTAAATGTGTCCTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146155.3-3137s1c1
Sequence:CCGGGAACCTCTTCACTGGCTATTTCTCGAGAAATAGCCAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks