EMAIL THIS PAGE TO A FRIEND

AHI1

Abelson helper integration site 1

132 Gene Product Result for
Synonyms: AHI-1 JBTS3 ORF1 dJ71N10.1
Gene ID:
Human(54806) Summary: This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Mouse(52906) Abelson helper integration site 1
Rat(308923) Abelson helper integration site 1
Zebrafish(562701) Abelson helper integration site 1
cow(528398) Abelson helper integration site 1
Horse(100073172) Abelson helper integration site 1
chicken(421693) Abelson helper integration site 1
dog(476212) Abelson helper integration site 1
domestic cat(101081636) Abelson helper integration site 1
sheep(101120502) Abelson helper integration site 1
Domestic Rabbit(100339239) Abelson helper integration site 1
domestic guinea pig(100719960) Abelson helper integration site 1
naked mole-rat(101717319) Abelson helper integration site 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017651 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017651 Rosetta Predictions human pricing
NM_001002277 Rosetta Predictions rat pricing
XM_579071 Rosetta Predictions rat pricing
NM_026203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036866 predicted 3582
2 SASI_Hs01_00036867 predicted 1973
3 SASI_Hs01_00036868 predicted 3192
4 SASI_Hs01_00036869 predicted 3403
5 SASI_Hs01_00036871 predicted 2473
6 SASI_Hs01_00036872 predicted 2398
7 SASI_Hs01_00036873 predicted 3798
8 SASI_Hs01_00036874 predicted 3332
9 SASI_Hs01_00036875 predicted 2695
10 SASI_Hs02_00350353 predicted 2746
11 SASI_Hs01_00036870 predicted 3095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109134 predicted 1189
2 SASI_Rn01_00109135 predicted 844
3 SASI_Rn01_00109136 predicted 2470
4 SASI_Rn01_00109138 predicted 2329
5 SASI_Rn01_00109139 predicted 2022
6 SASI_Rn01_00109140 predicted 1751
7 SASI_Rn01_00109141 predicted 1342
8 SASI_Rn02_00197967 predicted 606
9 SASI_Rn02_00197968 predicted 2710
10 SASI_Rn01_00109143 predicted 2859
11 SASI_Rn01_00109137 predicted 1710
12 SASI_Rn01_00109142 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160609 predicted 622
2 SASI_Rn01_00160610 predicted 846
3 SASI_Rn01_00160611 predicted 855
4 SASI_Rn01_00160612 predicted 743
5 SASI_Rn01_00160613 predicted 656
6 SASI_Rn01_00160614 predicted 485
7 SASI_Rn01_00160615 predicted 418
8 SASI_Rn01_00160616 predicted 552
9 SASI_Rn01_00160617 predicted 614
10 SASI_Rn01_00160618 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109336 predicted 2348
2 SASI_Mm01_00109337 predicted 3180
3 SASI_Mm02_00329871 predicted 1440
4 SASI_Mm01_00109338 predicted 3196
5 SASI_Mm01_00109339 predicted 2650
6 SASI_Mm02_00329872 predicted 3032
7 SASI_Mm01_00109340 predicted 1720
8 SASI_Mm01_00109342 predicted 2378
9 SASI_Mm01_00109344 predicted 2902
10 SASI_Mm01_00109345 predicted 2820
11 SASI_Mm01_00109341 predicted 866
12 SASI_Mm01_00109343 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026203
VALIDATED
AHI1 MISSION shRNA Bacterial Glycerol Stock
Abelson helper integration site 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026203.2-3921s21c1
Sequence:CCGGCTAAGTAGCTGCTGGATATTGCTCGAGCAATATCCAGCAGCTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1767s21c1
Sequence:CCGGCGAGACGGATATCCGATTATACTCGAGTATAATCGGATATCCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-2226s21c1
Sequence:CCGGGTGCGCCACTGGACGATAAATCTCGAGATTTATCGTCCAGTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1167s21c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026203.2-1067s21c1
Sequence:CCGGGGACTATATTCTCCCTATTATCTCGAGATAATAGGGAGAATATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3001s1c1
Sequence:CCGGCCAGCCGATCAGATGAACTAACTCGAGTTAGTTCATCTGATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-2586s1c1
Sequence:CCGGGCTGAAATGTTGAAACGCTATCTCGAGATAGCGTTTCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3044s1c1
Sequence:CCGGCCGAGTGTATTTCAAAGATAACTCGAGTTATCTTTGAAATACACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-1098s1c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-2537s1c1
Sequence:CCGGCGAGCCGATTCTTCTTTATATCTCGAGATATAAAGAAGAATCGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026203
VALIDATED
AHI1 MISSION shRNA shRNA Plasmid DNA
Abelson helper integration site 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026203.2-3921s21c1
Sequence:CCGGCTAAGTAGCTGCTGGATATTGCTCGAGCAATATCCAGCAGCTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1767s21c1
Sequence:CCGGCGAGACGGATATCCGATTATACTCGAGTATAATCGGATATCCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-2226s21c1
Sequence:CCGGGTGCGCCACTGGACGATAAATCTCGAGATTTATCGTCCAGTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1167s21c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026203.2-1067s21c1
Sequence:CCGGGGACTATATTCTCCCTATTATCTCGAGATAATAGGGAGAATATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3001s1c1
Sequence:CCGGCCAGCCGATCAGATGAACTAACTCGAGTTAGTTCATCTGATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-2586s1c1
Sequence:CCGGGCTGAAATGTTGAAACGCTATCTCGAGATAGCGTTTCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3044s1c1
Sequence:CCGGCCGAGTGTATTTCAAAGATAACTCGAGTTATCTTTGAAATACACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-1098s1c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-2537s1c1
Sequence:CCGGCGAGCCGATTCTTCTTTATATCTCGAGATATAAAGAAGAATCGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026203
VALIDATED
AHI1 MISSION shRNA Lentiviral Transduction Particles
Abelson helper integration site 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026203.2-3921s21c1
Sequence:CCGGCTAAGTAGCTGCTGGATATTGCTCGAGCAATATCCAGCAGCTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1767s21c1
Sequence:CCGGCGAGACGGATATCCGATTATACTCGAGTATAATCGGATATCCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-2226s21c1
Sequence:CCGGGTGCGCCACTGGACGATAAATCTCGAGATTTATCGTCCAGTGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026203.2-1167s21c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026203.2-1067s21c1
Sequence:CCGGGGACTATATTCTCCCTATTATCTCGAGATAATAGGGAGAATATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3001s1c1
Sequence:CCGGCCAGCCGATCAGATGAACTAACTCGAGTTAGTTCATCTGATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-2586s1c1
Sequence:CCGGGCTGAAATGTTGAAACGCTATCTCGAGATAGCGTTTCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-3044s1c1
Sequence:CCGGCCGAGTGTATTTCAAAGATAACTCGAGTTATCTTTGAAATACACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026203.1-1098s1c1
Sequence:CCGGCCCTATTTGCTTCGAGAGTTTCTCGAGAAACTCTCGAAGCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026203.1-2537s1c1
Sequence:CCGGCGAGCCGATTCTTCTTTATATCTCGAGATATAAAGAAGAATCGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017651
VALIDATED
AHI1 MISSION shRNA Bacterial Glycerol Stock
Abelson helper integration site 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-3501s1c1
Sequence:CCGGCGGAGACATTATCCGAGTGTTCTCGAGAACACTCGGATAATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-2479s1c1
Sequence:CCGGGCCATATTGGTCCGACAGTTTCTCGAGAAACTGTCGGACCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-3318s1c1
Sequence:CCGGGTCTAAGTTAAAGCAGTCAAACTCGAGTTTGACTGCTTTAACTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-1272s1c1
Sequence:CCGGCCCGGTTTATCCCAAATGTTTCTCGAGAAACATTTGGGATAAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-5196s1c1
Sequence:CCGGCCCAGTGTGAAATATCTTCTACTCGAGTAGAAGATATTTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-4289s1c1
Sequence:CCGGCCAGAATATGAAGTATCTGTTCTCGAGAACAGATACTTCATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2059s1c1
Sequence:CCGGGCTTGCCGTATCCCAAACAAACTCGAGTTTGTTTGGGATACGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2915s1c1
Sequence:CCGGCCATGTATTCTGACTTGCCATCTCGAGATGGCAAGTCAGAATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017651.3-1435s1c1
Sequence:CCGGCGGCCTGTTTCATCTTACTATCTCGAGATAGTAAGATGAAACAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017651
VALIDATED
AHI1 MISSION shRNA shRNA Plasmid DNA
Abelson helper integration site 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-3501s1c1
Sequence:CCGGCGGAGACATTATCCGAGTGTTCTCGAGAACACTCGGATAATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-2479s1c1
Sequence:CCGGGCCATATTGGTCCGACAGTTTCTCGAGAAACTGTCGGACCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-3318s1c1
Sequence:CCGGGTCTAAGTTAAAGCAGTCAAACTCGAGTTTGACTGCTTTAACTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-1272s1c1
Sequence:CCGGCCCGGTTTATCCCAAATGTTTCTCGAGAAACATTTGGGATAAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-5196s1c1
Sequence:CCGGCCCAGTGTGAAATATCTTCTACTCGAGTAGAAGATATTTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-4289s1c1
Sequence:CCGGCCAGAATATGAAGTATCTGTTCTCGAGAACAGATACTTCATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2059s1c1
Sequence:CCGGGCTTGCCGTATCCCAAACAAACTCGAGTTTGTTTGGGATACGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2915s1c1
Sequence:CCGGCCATGTATTCTGACTTGCCATCTCGAGATGGCAAGTCAGAATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017651.3-1435s1c1
Sequence:CCGGCGGCCTGTTTCATCTTACTATCTCGAGATAGTAAGATGAAACAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017651
VALIDATED
AHI1 MISSION shRNA Lentiviral Transduction Particles
Abelson helper integration site 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-3501s1c1
Sequence:CCGGCGGAGACATTATCCGAGTGTTCTCGAGAACACTCGGATAATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-2479s1c1
Sequence:CCGGGCCATATTGGTCCGACAGTTTCTCGAGAAACTGTCGGACCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-3318s1c1
Sequence:CCGGGTCTAAGTTAAAGCAGTCAAACTCGAGTTTGACTGCTTTAACTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017651.3-1272s1c1
Sequence:CCGGCCCGGTTTATCCCAAATGTTTCTCGAGAAACATTTGGGATAAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-5196s1c1
Sequence:CCGGCCCAGTGTGAAATATCTTCTACTCGAGTAGAAGATATTTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017651.3-4289s1c1
Sequence:CCGGCCAGAATATGAAGTATCTGTTCTCGAGAACAGATACTTCATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2059s1c1
Sequence:CCGGGCTTGCCGTATCCCAAACAAACTCGAGTTTGTTTGGGATACGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017651.3-2915s1c1
Sequence:CCGGCCATGTATTCTGACTTGCCATCTCGAGATGGCAAGTCAGAATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017651.3-1435s1c1
Sequence:CCGGCGGCCTGTTTCATCTTACTATCTCGAGATAGTAAGATGAAACAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks