EMAIL THIS PAGE TO A FRIEND

AHNAK2

AHNAK nucleoprotein 2

Synonyms: C14orf78
Gene ID:
Mouse(100041194) AHNAK nucleoprotein 2
Rat(314478) AHNAK nucleoprotein 2
chicken(423497) AHNAK nucleoprotein 2
dog(490881) AHNAK nucleoprotein 2
dog(612700) AHNAK nucleoprotein 2
cow(527701) AHNAK nucleoprotein 2
sheep(101104938) AHNAK nucleoprotein 2
domestic guinea pig(100725536) AHNAK nucleoprotein 2
naked mole-rat(101697171) AHNAK nucleoprotein 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003821 MISSION® esiRNA esiRNA targeting human AHNAK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138420 Rosetta Predictions human pricing
XM_290629 Rosetta Predictions human pricing
XM_001072924 Rosetta Predictions rat pricing
XM_234572 Rosetta Predictions rat pricing
XM_001475946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363562 predicted 15906
2 SASI_Hs02_00363563 predicted 16537
3 SASI_Hs02_00363564 predicted 14289
4 SASI_Hs02_00363565 predicted 599
5 SASI_Hs02_00363566 predicted 15396
6 SASI_Hs02_00363567 predicted 9103
7 SASI_Hs02_00363568 predicted 16732
8 SASI_Hs02_00363569 predicted 14194
9 SASI_Hs02_00363570 predicted 14301
10 SASI_Hs02_00363571 predicted 3160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252287 predicted 7691
2 SASI_Hs01_00252288 predicted 7578
3 SASI_Hs01_00252289 predicted 9014
4 SASI_Hs01_00252290 predicted 8120
5 SASI_Hs01_00252291 predicted 8907
6 SASI_Hs01_00252292 predicted 7772
7 SASI_Hs01_00252293 predicted 8267
8 SASI_Hs01_00252294 predicted 7871
9 SASI_Hs01_00252295 predicted 8794
10 SASI_Hs01_00252296 predicted 8834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340958 predicted 7397
2 SASI_Rn02_00340959 predicted 17174
3 SASI_Rn02_00340960 predicted 3364
4 SASI_Rn02_00340961 predicted 3443
5 SASI_Rn02_00340962 predicted 18012
6 SASI_Rn02_00340963 predicted 18082
7 SASI_Rn02_00340964 predicted 16885
8 SASI_Rn02_00340965 predicted 17331
9 SASI_Rn02_00340966 predicted 15606
10 SASI_Rn02_00340967 predicted 12979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388589 predicted 13740
2 SASI_Rn02_00388590 predicted 24010
3 SASI_Rn02_00388591 predicted 3432
4 SASI_Rn02_00388592 predicted 5052
5 SASI_Rn02_00388593 predicted 3505
6 SASI_Rn02_00388594 predicted 22188
7 SASI_Rn02_00388595 predicted 23728
8 SASI_Rn02_00388596 predicted 24169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385936 predicted 1242
2 SASI_Mm02_00385937 predicted 5901
3 SASI_Mm02_00385938 predicted 831
4 SASI_Mm02_00385939 predicted 699
5 SASI_Mm02_00385940 predicted 848
6 SASI_Mm02_00385941 predicted 895
7 SASI_Mm02_00385942 predicted 691
8 SASI_Mm02_00385943 predicted 904
9 SASI_Mm02_00385944 predicted 1336
10 SASI_Mm02_00385945 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138420
VALIDATED
AHNAK2 MISSION shRNA Bacterial Glycerol Stock
AHNAK nucleoprotein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-14198s21c1
Sequence:CCGGTTGGAATGGATTCGAAGTTTACTCGAGTAAACTTCGAATCCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-2001s21c1
Sequence:CCGGACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-1569s21c1
Sequence:CCGGGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCGTGTACTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-17960s21c1
Sequence:CCGGTCAGGCAGAGTGCGGTATATTCTCGAGAATATACCGCACTCTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-16361s21c1
Sequence:CCGGAGTGTCCAGAGGCCAATATTGCTCGAGCAATATTGGCCTCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138420
VALIDATED
AHNAK2 MISSION shRNA shRNA Plasmid DNA
AHNAK nucleoprotein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-14198s21c1
Sequence:CCGGTTGGAATGGATTCGAAGTTTACTCGAGTAAACTTCGAATCCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-2001s21c1
Sequence:CCGGACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-1569s21c1
Sequence:CCGGGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCGTGTACTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-17960s21c1
Sequence:CCGGTCAGGCAGAGTGCGGTATATTCTCGAGAATATACCGCACTCTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-16361s21c1
Sequence:CCGGAGTGTCCAGAGGCCAATATTGCTCGAGCAATATTGGCCTCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138420
VALIDATED
AHNAK2 MISSION shRNA Lentiviral Transduction Particles
AHNAK nucleoprotein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-14198s21c1
Sequence:CCGGTTGGAATGGATTCGAAGTTTACTCGAGTAAACTTCGAATCCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-2001s21c1
Sequence:CCGGACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-1569s21c1
Sequence:CCGGGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCGTGTACTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-17960s21c1
Sequence:CCGGTCAGGCAGAGTGCGGTATATTCTCGAGAATATACCGCACTCTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_138420.2-16361s21c1
Sequence:CCGGAGTGTCCAGAGGCCAATATTGCTCGAGCAATATTGGCCTCTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks