EMAIL THIS PAGE TO A FRIEND

AHNAK

AHNAK nucleoprotein

Synonyms: AHNAKRS
UniProtKB ID: Q09666, A1A586
Gene ID:
Mouse(66395) AHNAK nucleoprotein (desmoyokin)
Rat(191572) AHNAK nucleoprotein
naked mole-rat(101712409) AHNAK nucleoprotein
sheep(101110887) AHNAK nucleoprotein
Zebrafish(559276) AHNAK nucleoprotein
chicken(426546) AHNAK nucleoprotein
dog(497089) AHNAK nucleoprotein
dog(476059) AHNAK nucleoprotein
domestic cat(101087783) AHNAK nucleoprotein
cow(531336) AHNAK nucleoprotein
Horse(100063459) AHNAK nucleoprotein
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_009643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001620 Rosetta Predictions human pricing
NM_024060 Rosetta Predictions human pricing
XM_001078032 Rosetta Predictions rat pricing
XM_001078080 Rosetta Predictions rat pricing
XM_001078096 Rosetta Predictions rat pricing
XM_001078113 Rosetta Predictions rat pricing
XM_001078128 Rosetta Predictions rat pricing
XM_001078138 Rosetta Predictions rat pricing
XM_574618 Rosetta Predictions rat pricing
NM_001039959 Rosetta Predictions mouse pricing
NM_009643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212903 predicted 328
2 SASI_Hs01_00212904 predicted 387
3 SASI_Hs01_00212905 predicted 371
4 SASI_Hs01_00212906 predicted 379
5 SASI_Hs01_00212907 predicted 377
6 SASI_Hs01_00212908 predicted 389
7 SASI_Hs01_00212909 predicted 368
8 SASI_Hs01_00212910 predicted 314
9 SASI_Hs01_00212911 predicted 370
10 SASI_Hs01_00212912 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036896 predicted 333
2 SASI_Hs01_00036897 predicted 391
3 SASI_Hs01_00036898 predicted 372
4 SASI_Hs01_00036899 predicted 379
5 SASI_Hs01_00036900 predicted 376
6 SASI_Hs01_00036901 predicted 380
7 SASI_Hs01_00036902 predicted 376
8 SASI_Hs01_00036903 predicted 306
9 SASI_Hs01_00036904 predicted 373
10 SASI_Hs01_00036905 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359423 predicted 1923
2 SASI_Rn02_00359424 predicted 934
3 SASI_Rn02_00359425 predicted 5263
4 SASI_Rn02_00359426 predicted 1993
5 SASI_Rn02_00359427 predicted 5471
6 SASI_Rn02_00359428 predicted 7052
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359599 predicted 691
2 SASI_Rn02_00359600 predicted 292
3 SASI_Rn02_00359601 predicted 2572
4 SASI_Rn02_00359602 predicted 4191
5 SASI_Rn02_00359603 predicted 362
6 SASI_Rn02_00359604 predicted 4359
7 SASI_Rn02_00359605 predicted 1822
8 SASI_Rn02_00359606 predicted 5942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359647 predicted 695
2 SASI_Rn02_00359648 predicted 294
3 SASI_Rn02_00359649 predicted 2410
4 SASI_Rn02_00359650 predicted 4229
5 SASI_Rn02_00359651 predicted 362
6 SASI_Rn02_00359652 predicted 4444
7 SASI_Rn02_00359653 predicted 1829
8 SASI_Rn02_00359654 predicted 6029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359685 predicted 698
2 SASI_Rn02_00359686 predicted 295
3 SASI_Rn02_00359687 predicted 2412
4 SASI_Rn02_00359688 predicted 4231
5 SASI_Rn02_00359689 predicted 369
6 SASI_Rn02_00359690 predicted 4453
7 SASI_Rn02_00359691 predicted 1666
8 SASI_Rn02_00359692 predicted 6029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359733 predicted 695
2 SASI_Rn02_00359734 predicted 297
3 SASI_Rn02_00359735 predicted 2575
4 SASI_Rn02_00359736 predicted 4398
5 SASI_Rn02_00359737 predicted 369
6 SASI_Rn02_00359738 predicted 4613
7 SASI_Rn02_00359739 predicted 1829
8 SASI_Rn02_00359740 predicted 6189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359781 predicted 698
2 SASI_Rn02_00359782 predicted 293
3 SASI_Rn02_00359783 predicted 2570
4 SASI_Rn02_00359784 predicted 4189
5 SASI_Rn02_00359785 predicted 360
6 SASI_Rn02_00359786 predicted 4414
7 SASI_Rn02_00359787 predicted 2212
8 SASI_Rn02_00359788 predicted 5989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402286 predicted 290
2 SASI_Rn02_00402287 predicted 3332
3 SASI_Rn02_00402288 predicted 6131
4 SASI_Rn02_00402289 predicted 360
5 SASI_Rn02_00402290 predicted 6353
6 SASI_Rn02_00402291 predicted 7932
7 SASI_Rn02_00402292 predicted 978
8 SASI_Rn02_00402293 predicted 9008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128548 predicted 891
2 SASI_Mm01_00128550 predicted 975
3 SASI_Mm01_00128551 predicted 469
4 SASI_Mm01_00128553 predicted 1003
5 SASI_Mm01_00128554 predicted 979
6 SASI_Mm01_00128555 predicted 939
7 SASI_Mm02_00290251 predicted 558
8 SASI_Mm01_00128556 predicted 621
9 SASI_Mm01_00128557 predicted 873
10 SASI_Mm02_00290252 predicted 411
11 SASI_Mm01_00128549 predicted 997
12 SASI_Mm01_00128552 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094602 predicted 7594
2 SASI_Mm01_00094604 predicted 6260
3 SASI_Mm02_00316622 predicted 14216
4 SASI_Mm01_00094606 predicted 12992
5 SASI_Mm02_00316623 predicted 12631
6 SASI_Mm02_00316624 predicted 16983
7 SASI_Mm02_00316625 predicted 6063
8 SASI_Mm02_00316626 predicted 14526
9 SASI_Mm01_00094603 predicted 8017
10 SASI_Mm01_00094605 predicted 16120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001620
AHNAK MISSION shRNA Bacterial Glycerol Stock
AHNAK nucleoprotein
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000130911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-12084s1c1
Sequence:CCGGGCACCTGAAGATGCCTAAGATCTCGAGATCTTAGGCATCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-2535s1c1
Sequence:CCGGGCACTTGAAGATGCCCAAGATCTCGAGATCTTGGGCATCTTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001620
AHNAK MISSION shRNA shRNA Plasmid DNA
AHNAK nucleoprotein
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000130911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-12084s1c1
Sequence:CCGGGCACCTGAAGATGCCTAAGATCTCGAGATCTTAGGCATCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-2535s1c1
Sequence:CCGGGCACTTGAAGATGCCCAAGATCTCGAGATCTTGGGCATCTTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001620
AHNAK MISSION shRNA Lentiviral Transduction Particles
AHNAK nucleoprotein
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000130911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-12084s1c1
Sequence:CCGGGCACCTGAAGATGCCTAAGATCTCGAGATCTTAGGCATCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001620.1-2535s1c1
Sequence:CCGGGCACTTGAAGATGCCCAAGATCTCGAGATCTTGGGCATCTTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024060
VALIDATED
AHNAK MISSION shRNA Bacterial Glycerol Stock
AHNAK nucleoprotein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024060.2-955s1c1
Sequence:CCGGCCCTGCTTGGTGCATTTCTTTCTCGAGAAAGAAATGCACCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-676s1c1
Sequence:CCGGGACCAGAACAAACAGAAGGAACTCGAGTTCCTTCTGTTTGTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024060.2-623s1c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-655s1c1
Sequence:CCGGCCATCAGCACTGGAATGCAAACTCGAGTTTGCATTCCAGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-623s21c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024060.2-898s21c1
Sequence:CCGGTTCGGAGCATGCATGTTTATACTCGAGTATAAACATGCATGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-467s21c1
Sequence:CCGGTGGGTGCCACCATCTACTTTGCTCGAGCAAAGTAGATGGTGGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024060
VALIDATED
AHNAK MISSION shRNA shRNA Plasmid DNA
AHNAK nucleoprotein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024060.2-955s1c1
Sequence:CCGGCCCTGCTTGGTGCATTTCTTTCTCGAGAAAGAAATGCACCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-676s1c1
Sequence:CCGGGACCAGAACAAACAGAAGGAACTCGAGTTCCTTCTGTTTGTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024060.2-623s1c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-655s1c1
Sequence:CCGGCCATCAGCACTGGAATGCAAACTCGAGTTTGCATTCCAGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-623s21c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024060.2-898s21c1
Sequence:CCGGTTCGGAGCATGCATGTTTATACTCGAGTATAAACATGCATGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-467s21c1
Sequence:CCGGTGGGTGCCACCATCTACTTTGCTCGAGCAAAGTAGATGGTGGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024060
VALIDATED
AHNAK MISSION shRNA Lentiviral Transduction Particles
AHNAK nucleoprotein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024060.2-955s1c1
Sequence:CCGGCCCTGCTTGGTGCATTTCTTTCTCGAGAAAGAAATGCACCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-676s1c1
Sequence:CCGGGACCAGAACAAACAGAAGGAACTCGAGTTCCTTCTGTTTGTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024060.2-623s1c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024060.2-655s1c1
Sequence:CCGGCCATCAGCACTGGAATGCAAACTCGAGTTTGCATTCCAGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-623s21c1
Sequence:CCGGGCAGCTCTGAAGTGGTTCTGACTCGAGTCAGAACCACTTCAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024060.2-898s21c1
Sequence:CCGGTTCGGAGCATGCATGTTTATACTCGAGTATAAACATGCATGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024060.2-467s21c1
Sequence:CCGGTGGGTGCCACCATCTACTTTGCTCGAGCAAAGTAGATGGTGGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175108
VALIDATED
AHNAK MISSION shRNA Bacterial Glycerol Stock
AHNAK nucleoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-902s1c1
Sequence:CCGGGTGATTGTTCTTTGGAGCATTCTCGAGAATGCTCCAAAGAACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-594s1c1
Sequence:CCGGGTGGTTCTGAACACGGTACAACTCGAGTTGTACCGTGTTCAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-431s1c1
Sequence:CCGGTGCCACCATCTACTTTGACAACTCGAGTTGTCAAAGTAGATGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-625s1c1
Sequence:CCGGTGGACTGCAATGACCAGAATACTCGAGTATTCTGGTCATTGCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-506s1c1
Sequence:CCGGTGGCTTGAAGTTGCACCGTAACTCGAGTTACGGTGCAACTTCAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175108
VALIDATED
AHNAK MISSION shRNA shRNA Plasmid DNA
AHNAK nucleoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-902s1c1
Sequence:CCGGGTGATTGTTCTTTGGAGCATTCTCGAGAATGCTCCAAAGAACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-594s1c1
Sequence:CCGGGTGGTTCTGAACACGGTACAACTCGAGTTGTACCGTGTTCAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-431s1c1
Sequence:CCGGTGCCACCATCTACTTTGACAACTCGAGTTGTCAAAGTAGATGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-625s1c1
Sequence:CCGGTGGACTGCAATGACCAGAATACTCGAGTATTCTGGTCATTGCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-506s1c1
Sequence:CCGGTGGCTTGAAGTTGCACCGTAACTCGAGTTACGGTGCAACTTCAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175108
VALIDATED
AHNAK MISSION shRNA Lentiviral Transduction Particles
AHNAK nucleoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-902s1c1
Sequence:CCGGGTGATTGTTCTTTGGAGCATTCTCGAGAATGCTCCAAAGAACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-594s1c1
Sequence:CCGGGTGGTTCTGAACACGGTACAACTCGAGTTGTACCGTGTTCAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-431s1c1
Sequence:CCGGTGCCACCATCTACTTTGACAACTCGAGTTGTCAAAGTAGATGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-625s1c1
Sequence:CCGGTGGACTGCAATGACCAGAATACTCGAGTATTCTGGTCATTGCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175108.3-506s1c1
Sequence:CCGGTGGCTTGAAGTTGCACCGTAACTCGAGTTACGGTGCAACTTCAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009643
AHNAK MISSION shRNA Bacterial Glycerol Stock
AHNAK nucleoprotein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-5357s21c1
Sequence:CCGGGCCTGATGTTGGGCTTAATTTCTCGAGAAATTAAGCCCAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-3940s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17391s21c1
Sequence:CCGGGGGACTCTGCAGCTAGGTAAACTCGAGTTTACCTAGCTGCAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-7577s21c1
Sequence:CCGGTGACTTTGATTTGCATCTTAACTCGAGTTAAGATGCAAATCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-13249s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAACCTCGAGGTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17544s21c1
Sequence:CCGGACGCTGAGAGCTCGTGTTTACCTCGAGGTAAACACGAGCTCTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009643
AHNAK MISSION shRNA shRNA Plasmid DNA
AHNAK nucleoprotein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-5357s21c1
Sequence:CCGGGCCTGATGTTGGGCTTAATTTCTCGAGAAATTAAGCCCAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-3940s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17391s21c1
Sequence:CCGGGGGACTCTGCAGCTAGGTAAACTCGAGTTTACCTAGCTGCAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-7577s21c1
Sequence:CCGGTGACTTTGATTTGCATCTTAACTCGAGTTAAGATGCAAATCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-13249s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAACCTCGAGGTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17544s21c1
Sequence:CCGGACGCTGAGAGCTCGTGTTTACCTCGAGGTAAACACGAGCTCTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009643
AHNAK MISSION shRNA Lentiviral Transduction Particles
AHNAK nucleoprotein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-5357s21c1
Sequence:CCGGGCCTGATGTTGGGCTTAATTTCTCGAGAAATTAAGCCCAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-3940s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17391s21c1
Sequence:CCGGGGGACTCTGCAGCTAGGTAAACTCGAGTTTACCTAGCTGCAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-7577s21c1
Sequence:CCGGTGACTTTGATTTGCATCTTAACTCGAGTTAAGATGCAAATCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009643.1-13249s21c1
Sequence:CCGGTGGATATCAAAGGCCCTAAACCTCGAGGTTTAGGGCCTTTGATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009643.1-17544s21c1
Sequence:CCGGACGCTGAGAGCTCGTGTTTACCTCGAGGTAAACACGAGCTCTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks