EMAIL THIS PAGE TO A FRIEND

AHRR

aryl-hydrocarbon receptor repressor

101 Gene Product Result for
Synonyms: AHH AHHR bHLHe77
UniProtKB ID: A9YTQ3, A7MBN5, D6RAZ1, Q9HAZ3, Q9ULI6
Gene ID:
Human(57491) Summary: The protein encoded by this gene participates in the aryl hydrocarbon receptor (AhR) signaling cascade, which mediates dioxin toxicity, and is involved in regulation of cell growth and differentiation. It functions as a feedback modulator by repressing AhR-dependent gene expression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2011]
Mouse(11624) aryl-hydrocarbon receptor repressor
Rat(498999) aryl-hydrocarbon receptor repressor
chicken(420989) aryl-hydrocarbon receptor repressor
domestic cat(101082724) aryl-hydrocarbon receptor repressor
dog(488074) aryl-hydrocarbon receptor repressor
sheep(101109301) aryl-hydrocarbon receptor repressor
domestic guinea pig(100735234) aryl-hydrocarbon receptor repressor
naked mole-rat(101724999) aryl-hydrocarbon receptor repressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020731 Rosetta Predictions human pricing
NM_001024285 Rosetta Predictions rat pricing
NM_009644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353810 predicted 501
2 SASI_Hs01_00213384 predicted 433
3 SASI_Hs02_00353811 predicted 494
4 SASI_Hs01_00213385 predicted 1802
5 SASI_Hs01_00213386 predicted 410
6 SASI_Hs01_00213387 predicted 1034
7 SASI_Hs02_00353812 predicted 1030
8 SASI_Hs01_00213390 predicted 816
9 SASI_Hs01_00213392 predicted 486
10 SASI_Hs02_00353813 predicted 803
11 SASI_Hs01_00213383 predicted 407
12 SASI_Hs01_00213388 predicted 434
13 SASI_Hs01_00213389 predicted 277
14 SASI_Hs01_00213391 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202468 predicted 1932
2 SASI_Rn01_00116485 predicted 2129
3 SASI_Rn01_00116486 predicted 1019
4 SASI_Rn01_00116487 predicted 467
5 SASI_Rn01_00116488 predicted 2115
6 SASI_Rn01_00116490 predicted 911
7 SASI_Rn01_00116491 predicted 1706
8 SASI_Rn01_00116492 predicted 1526
9 SASI_Rn02_00202469 predicted 1784
10 SASI_Rn01_00116493 predicted 283
11 SASI_Rn01_00116484 predicted 1839
12 SASI_Rn01_00116489 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316627 predicted 1026
2 SASI_Mm01_00120656 predicted 1014
3 SASI_Mm02_00316628 predicted 1699
4 SASI_Mm01_00120657 predicted 2239
5 SASI_Mm01_00120658 predicted 294
6 SASI_Mm01_00120660 predicted 946
7 SASI_Mm01_00120661 predicted 2048
8 SASI_Mm01_00120662 predicted 493
9 SASI_Mm01_00120664 predicted 706
10 SASI_Mm01_00120665 predicted 1274
11 SASI_Mm01_00120659 predicted 256
12 SASI_Mm01_00120663 predicted 2213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009644
AHRR MISSION shRNA Bacterial Glycerol Stock
aryl-hydrocarbon receptor repressor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2599s21c1
Sequence:CCGGGGTCGCTGAGTATGGTTTATGCTCGAGCATAAACCATACTCAGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-1249s21c1
Sequence:CCGGGAGATGCACAAGTACAGTTATCTCGAGATAACTGTACTTGTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009644.1-2545s1c1
Sequence:CCGGCCGAGGCTGTACTTTGCATAACTCGAGTTATGCAAAGTACAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-1733s1c1
Sequence:CCGGCCCAGGATATAGTTGAAGCTACTCGAGTAGCTTCAACTATATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-998s1c1
Sequence:CCGGCAAGTCTATGTGAATCAGAATCTCGAGATTCTGATTCACATAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-733s1c1
Sequence:CCGGCGCTGCTTCATTTGTCGTGTTCTCGAGAACACGACAAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-865s1c1
Sequence:CCGGCGACTCTCATTGTTCTGCATTCTCGAGAATGCAGAACAATGAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-479s21c1
Sequence:CCGGTTTATGCATCGGCAACAATTGCTCGAGCAATTGTTGCCGATGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2625s21c1
Sequence:CCGGGTGTCTCTGAGTACATCATATCTCGAGATATGATGTACTCAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009644
AHRR MISSION shRNA shRNA Plasmid DNA
aryl-hydrocarbon receptor repressor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2599s21c1
Sequence:CCGGGGTCGCTGAGTATGGTTTATGCTCGAGCATAAACCATACTCAGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-1249s21c1
Sequence:CCGGGAGATGCACAAGTACAGTTATCTCGAGATAACTGTACTTGTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009644.1-2545s1c1
Sequence:CCGGCCGAGGCTGTACTTTGCATAACTCGAGTTATGCAAAGTACAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-1733s1c1
Sequence:CCGGCCCAGGATATAGTTGAAGCTACTCGAGTAGCTTCAACTATATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-998s1c1
Sequence:CCGGCAAGTCTATGTGAATCAGAATCTCGAGATTCTGATTCACATAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-733s1c1
Sequence:CCGGCGCTGCTTCATTTGTCGTGTTCTCGAGAACACGACAAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-865s1c1
Sequence:CCGGCGACTCTCATTGTTCTGCATTCTCGAGAATGCAGAACAATGAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-479s21c1
Sequence:CCGGTTTATGCATCGGCAACAATTGCTCGAGCAATTGTTGCCGATGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2625s21c1
Sequence:CCGGGTGTCTCTGAGTACATCATATCTCGAGATATGATGTACTCAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009644
AHRR MISSION shRNA Lentiviral Transduction Particles
aryl-hydrocarbon receptor repressor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2599s21c1
Sequence:CCGGGGTCGCTGAGTATGGTTTATGCTCGAGCATAAACCATACTCAGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-1249s21c1
Sequence:CCGGGAGATGCACAAGTACAGTTATCTCGAGATAACTGTACTTGTGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009644.1-2545s1c1
Sequence:CCGGCCGAGGCTGTACTTTGCATAACTCGAGTTATGCAAAGTACAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-1733s1c1
Sequence:CCGGCCCAGGATATAGTTGAAGCTACTCGAGTAGCTTCAACTATATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-998s1c1
Sequence:CCGGCAAGTCTATGTGAATCAGAATCTCGAGATTCTGATTCACATAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-733s1c1
Sequence:CCGGCGCTGCTTCATTTGTCGTGTTCTCGAGAACACGACAAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009644.1-865s1c1
Sequence:CCGGCGACTCTCATTGTTCTGCATTCTCGAGAATGCAGAACAATGAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009644.2-479s21c1
Sequence:CCGGTTTATGCATCGGCAACAATTGCTCGAGCAATTGTTGCCGATGCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009644.2-2625s21c1
Sequence:CCGGGTGTCTCTGAGTACATCATATCTCGAGATATGATGTACTCAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020731
VALIDATED
AHRR MISSION shRNA Bacterial Glycerol Stock
aryl-hydrocarbon receptor repressor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020731.2-1809s1c1
Sequence:CCGGCCTACCAGGATGCACCTGAAACTCGAGTTTCAGGTGCATCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-2295s21c1
Sequence:CCGGCGTCCTAAGACACACGCTTTGCTCGAGCAAAGCGTGTGTCTTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-463s21c1
Sequence:CCGGCAGCAACGATCGTGGACTATCCTCGAGGATAGTCCACGATCGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-488s21c1
Sequence:CCGGCTTCCATCAGACGGATGTAATCTCGAGATTACATCCGTCTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-435s21c1
Sequence:CCGGAGTGCAGAAGGGACGATATTTCTCGAGAAATATCGTCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-1621s21c1
Sequence:CCGGGCTATCCCATGGAGGACATGACTCGAGTCATGTCCTCCATGGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020731.3-2428s21c1
Sequence:CCGGATTCAAGCATGACAGCATTTCCTCGAGGAAATGCTGTCATGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020731.3-397s21c1
Sequence:CCGGTGCTGTTGGAGTCTCTTAATGCTCGAGCATTAAGAGACTCCAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020731
VALIDATED
AHRR MISSION shRNA shRNA Plasmid DNA
aryl-hydrocarbon receptor repressor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020731.2-1809s1c1
Sequence:CCGGCCTACCAGGATGCACCTGAAACTCGAGTTTCAGGTGCATCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-2295s21c1
Sequence:CCGGCGTCCTAAGACACACGCTTTGCTCGAGCAAAGCGTGTGTCTTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-463s21c1
Sequence:CCGGCAGCAACGATCGTGGACTATCCTCGAGGATAGTCCACGATCGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-488s21c1
Sequence:CCGGCTTCCATCAGACGGATGTAATCTCGAGATTACATCCGTCTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-435s21c1
Sequence:CCGGAGTGCAGAAGGGACGATATTTCTCGAGAAATATCGTCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-1621s21c1
Sequence:CCGGGCTATCCCATGGAGGACATGACTCGAGTCATGTCCTCCATGGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020731.3-2428s21c1
Sequence:CCGGATTCAAGCATGACAGCATTTCCTCGAGGAAATGCTGTCATGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020731.3-397s21c1
Sequence:CCGGTGCTGTTGGAGTCTCTTAATGCTCGAGCATTAAGAGACTCCAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020731
VALIDATED
AHRR MISSION shRNA Lentiviral Transduction Particles
aryl-hydrocarbon receptor repressor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020731.2-1809s1c1
Sequence:CCGGCCTACCAGGATGCACCTGAAACTCGAGTTTCAGGTGCATCCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-2295s21c1
Sequence:CCGGCGTCCTAAGACACACGCTTTGCTCGAGCAAAGCGTGTGTCTTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-463s21c1
Sequence:CCGGCAGCAACGATCGTGGACTATCCTCGAGGATAGTCCACGATCGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-488s21c1
Sequence:CCGGCTTCCATCAGACGGATGTAATCTCGAGATTACATCCGTCTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-435s21c1
Sequence:CCGGAGTGCAGAAGGGACGATATTTCTCGAGAAATATCGTCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020731.3-1621s21c1
Sequence:CCGGGCTATCCCATGGAGGACATGACTCGAGTCATGTCCTCCATGGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020731.3-2428s21c1
Sequence:CCGGATTCAAGCATGACAGCATTTCCTCGAGGAAATGCTGTCATGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020731.3-397s21c1
Sequence:CCGGTGCTGTTGGAGTCTCTTAATGCTCGAGCATTAAGAGACTCCAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks