EMAIL THIS PAGE TO A FRIEND

AHSA1

AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)

83 Gene Product Result for
Synonyms: AHA1 C14orf3 p38
UniProtKB ID: O95433, B2R9L2, Q96IL6, Q9P060
Gene ID:
Mouse(217737) AHA1, activator of heat shock protein ATPase 1
Rat(681996) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Zebrafish(565968) AHA1, activator of heat shock protein ATPase homolog 1 (yeast)
dog(480402) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Horse(100052370) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
cow(539220) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
domestic cat(101086318) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
chicken(423378) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
naked mole-rat(101703069) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
domestic guinea pig(100719334) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
sheep(101115128) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Domestic Rabbit(100355729) AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5200098 Anti-AHSA antibody produced in rabbit whole antiserum human, mouse, rat
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1407021 Anti-AHSA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA000903 Anti-AHSA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500134 Anti-AHSA1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1410110 Anti-AHSA1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0010598M1 Monoclonal Anti-AHSA1 antibody produced in mouse clone 1A2-A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404847 Monoclonal Anti-AHSA1 antibody produced in mouse clone 4F3-B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing
SAB5200013 Monoclonal Anti-AHSA1 antibody produced in mouse clone 25F2.D9, 1 mg/mL, purified immunoglobulin mouse, human, rat
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200014 Monoclonal Anti-AHSA1 antibody produced in mouse clone 25F2.D10, 1 mg/mL, purified immunoglobulin mouse, human, rat
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012111 Rosetta Predictions human pricing
NM_001115034 Rosetta Predictions rat pricing
NM_146036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343637 predicted 923
2 SASI_Hs01_00118308 predicted 741
3 SASI_Hs01_00118310 predicted 558
4 SASI_Hs01_00118311 predicted 593
5 SASI_Hs01_00118312 predicted 517
6 SASI_Hs01_00118313 predicted 331
7 SASI_Hs01_00118314 predicted 374
8 SASI_Hs01_00118315 predicted 407
9 SASI_Hs02_00343638 predicted 470
10 SASI_Hs02_00343639 predicted 947
11 SASI_Hs01_00118309 predicted 1090
12 SASI_Hs01_00118316 predicted 869
13 SASI_Hs01_00118317 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252513 predicted 935
2 SASI_Rn02_00252514 predicted 1095
3 SASI_Rn02_00252515 predicted 510
4 SASI_Rn02_00252516 predicted 526
5 SASI_Rn02_00252517 predicted 1133
6 SASI_Rn02_00252518 predicted 428
7 SASI_Rn02_00252519 predicted 942
8 SASI_Rn02_00252520 predicted 227
9 SASI_Rn02_00252521 predicted 696
10 SASI_Rn02_00252522 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143052 predicted 346
2 SASI_Mm02_00341627 predicted 551
3 SASI_Mm01_00143054 predicted 507
4 SASI_Mm01_00143055 predicted 683
5 SASI_Mm02_00341628 predicted 1082
6 SASI_Mm01_00143056 predicted 735
7 SASI_Mm01_00143057 predicted 393
8 SASI_Mm01_00143058 predicted 929
9 SASI_Mm02_00341629 predicted 462
10 SASI_Mm02_00341630 predicted 940
11 SASI_Mm01_00143053 predicted 417
12 SASI_Mm01_00143059 predicted 742
13 SASI_Mm01_00143060 predicted 691
14 SASI_Mm01_00143061 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012111
VALIDATED
AHSA1 MISSION shRNA Bacterial Glycerol Stock
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012111.1-316s21c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-344s21c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-1092s21c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-333s21c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-926s21c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-316s1c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012111.1-338s1c1
Sequence:CCGGCATTAACAATCGCAAAGGGAACTCGAGTTCCCTTTGCGATTGTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-344s1c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-333s1c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-1092s1c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-926s1c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012111
VALIDATED
AHSA1 MISSION shRNA shRNA Plasmid DNA
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012111.1-316s21c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-344s21c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-1092s21c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-333s21c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-926s21c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-316s1c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012111.1-338s1c1
Sequence:CCGGCATTAACAATCGCAAAGGGAACTCGAGTTCCCTTTGCGATTGTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-344s1c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-333s1c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-1092s1c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-926s1c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012111
VALIDATED
AHSA1 MISSION shRNA Lentiviral Transduction Particles
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012111.1-316s21c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-344s21c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-1092s21c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-333s21c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012111.1-926s21c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-316s1c1
Sequence:CCGGGTAAGCTTGATGGAGAGGCATCTCGAGATGCCTCTCCATCAAGCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012111.1-338s1c1
Sequence:CCGGCATTAACAATCGCAAAGGGAACTCGAGTTCCCTTTGCGATTGTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-344s1c1
Sequence:CCGGCAATCGCAAAGGGAAACTTATCTCGAGATAAGTTTCCCTTTGCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-333s1c1
Sequence:CCGGGCATCCATTAACAATCGCAAACTCGAGTTTGCGATTGTTAATGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-1092s1c1
Sequence:CCGGCGGTACTACTTTGAGGGCATTCTCGAGAATGCCCTCAAAGTAGTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012111.1-926s1c1
Sequence:CCGGCCCTGAGAAACATATTGTGATCTCGAGATCACAATATGTTTCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146036
VALIDATED
AHSA1 MISSION shRNA Bacterial Glycerol Stock
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146036.1-1158s21c1
Sequence:CCGGTCTGGCCCTGTTGAAACTTTACTCGAGTAAAGTTTCAACAGGGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-337s21c1
Sequence:CCGGCAACAGGAAAGGCAAACTTATCTCGAGATAAGTTTGCCTTTCCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146036.1-934s21c1
Sequence:CCGGTGCTATGAAGTGGAGGTTTAACTCGAGTTAAACCTCCACTTCATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-405s21c1
Sequence:CCGGAGTCAGGAGTGCAGTACAAAGCTCGAGCTTTGTACTGCACTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-740s21c1
Sequence:CCGGACTTGTAAGATCACCCTTAAACTCGAGTTTAAGGGTGATCTTACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146036
VALIDATED
AHSA1 MISSION shRNA shRNA Plasmid DNA
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146036.1-1158s21c1
Sequence:CCGGTCTGGCCCTGTTGAAACTTTACTCGAGTAAAGTTTCAACAGGGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-337s21c1
Sequence:CCGGCAACAGGAAAGGCAAACTTATCTCGAGATAAGTTTGCCTTTCCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146036.1-934s21c1
Sequence:CCGGTGCTATGAAGTGGAGGTTTAACTCGAGTTAAACCTCCACTTCATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-405s21c1
Sequence:CCGGAGTCAGGAGTGCAGTACAAAGCTCGAGCTTTGTACTGCACTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-740s21c1
Sequence:CCGGACTTGTAAGATCACCCTTAAACTCGAGTTTAAGGGTGATCTTACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146036
VALIDATED
AHSA1 MISSION shRNA Lentiviral Transduction Particles
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146036.1-1158s21c1
Sequence:CCGGTCTGGCCCTGTTGAAACTTTACTCGAGTAAAGTTTCAACAGGGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-337s21c1
Sequence:CCGGCAACAGGAAAGGCAAACTTATCTCGAGATAAGTTTGCCTTTCCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146036.1-934s21c1
Sequence:CCGGTGCTATGAAGTGGAGGTTTAACTCGAGTTAAACCTCCACTTCATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-405s21c1
Sequence:CCGGAGTCAGGAGTGCAGTACAAAGCTCGAGCTTTGTACTGCACTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146036.1-740s21c1
Sequence:CCGGACTTGTAAGATCACCCTTAAACTCGAGTTTAAGGGTGATCTTACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)