EMAIL THIS PAGE TO A FRIEND

AHSA2

AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)

68 Gene Product Result for
Synonyms: Hch1
UniProtKB ID: Q719I0, B3KS51, D6W5E0, Q8NDU5
Gene ID:
Mouse(268390) AHA1, activator of heat shock protein ATPase 2
Rat(305577) AHA1, activator of heat shock protein ATPase 2
chicken(421194) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
cow(531017) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
dog(100683748) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
sheep(101119030) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
domestic guinea pig(100718847) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
naked mole-rat(101725780) AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152392 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152392 Rosetta Predictions human pricing
NM_001107241 Rosetta Predictions rat pricing
NM_172391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366064 predicted 1893
2 SASI_Hs01_00176110 predicted 1830
3 SASI_Hs01_00176112 predicted 1644
4 SASI_Hs01_00176113 predicted 1759
5 SASI_Hs01_00176114 predicted 1714
6 SASI_Hs01_00176115 predicted 1869
7 SASI_Hs01_00176116 predicted 1892
8 SASI_Hs01_00176118 predicted 1700
9 SASI_Hs01_00176119 predicted 1857
10 SASI_Hs02_00366065 predicted 1805
11 SASI_Hs01_00176111 predicted 1623
12 SASI_Hs01_00176117 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226905 predicted 765
2 SASI_Rn02_00226906 predicted 1529
3 SASI_Rn02_00226907 predicted 852
4 SASI_Rn02_00226908 predicted 800
5 SASI_Rn02_00226909 predicted 754
6 SASI_Rn02_00226910 predicted 1502
7 SASI_Rn02_00226911 predicted 1507
8 SASI_Rn02_00226912 predicted 769
9 SASI_Rn02_00226913 predicted 1377
10 SASI_Rn02_00226914 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107506 predicted 844
2 SASI_Mm01_00107507 predicted 716
3 SASI_Mm01_00107508 predicted 556
4 SASI_Mm01_00107509 predicted 365
5 SASI_Mm01_00107510 predicted 247
6 SASI_Mm01_00107511 predicted 547
7 SASI_Mm01_00107512 predicted 293
8 SASI_Mm01_00107513 predicted 535
9 SASI_Mm01_00107514 predicted 1078
10 SASI_Mm02_00343827 predicted 701
11 SASI_Mm01_00107515 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152392
VALIDATED
AHSA2 MISSION shRNA Bacterial Glycerol Stock
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1728s1c1
Sequence:CCGGGAACTGTTTGACACAACTGTACTCGAGTACAGTTGTGTCAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152392.1-1899s1c1
Sequence:CCGGGAGTTCCTATCTATCTGTAAACTCGAGTTTACAGATAGATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1757s1c1
Sequence:CCGGGTATAGCATCTTCACTGTAAACTCGAGTTTACAGTGAAGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1882s1c1
Sequence:CCGGCAGAATTACAATTGAAGGAGTCTCGAGACTCCTTCAATTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1904s1c1
Sequence:CCGGCCTATCTATCTGTAAAGAAGACTCGAGTCTTCTTTACAGATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1928s1c1
Sequence:CCGGCATGAAATTCTGTTGGCAGAACTCGAGTTCTGCCAACAGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1763s1c1
Sequence:CCGGCATCTTCACTGTAAAGGAGTTCTCGAGAACTCCTTTACAGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1826s1c1
Sequence:CCGGGCCAGAAGAACACTATGCCATCTCGAGATGGCATAGTGTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2125s21c1
Sequence:CCGGTGTGCCTACTCTAGGGCAAACCTCGAGGTTTGCCCTAGAGTAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2476s21c1
Sequence:CCGGACCTGACCTTCCATCGATATTCTCGAGAATATCGATGGAAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2659s21c1
Sequence:CCGGGTGTAGATCTTAGGTCGTAAACTCGAGTTTACGACCTAAGATCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2177s21c1
Sequence:CCGGTGTAAAGAAGAGAACATGAAACTCGAGTTTCATGTTCTCTTCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-1966s21c1
Sequence:CCGGTCCCACTGTGGCTCTTCACATCTCGAGATGTGAAGAGCCACAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2510s21c1
Sequence:CCGGGTAAGTCCTGAGTGCAGATAGCTCGAGCTATCTGCACTCAGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2075s21c1
Sequence:CCGGAGATGTGGGAACTGGCCAGAACTCGAGTTCTGGCCAGTTCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152392
VALIDATED
AHSA2 MISSION shRNA shRNA Plasmid DNA
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1728s1c1
Sequence:CCGGGAACTGTTTGACACAACTGTACTCGAGTACAGTTGTGTCAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152392.1-1899s1c1
Sequence:CCGGGAGTTCCTATCTATCTGTAAACTCGAGTTTACAGATAGATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1757s1c1
Sequence:CCGGGTATAGCATCTTCACTGTAAACTCGAGTTTACAGTGAAGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1882s1c1
Sequence:CCGGCAGAATTACAATTGAAGGAGTCTCGAGACTCCTTCAATTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1904s1c1
Sequence:CCGGCCTATCTATCTGTAAAGAAGACTCGAGTCTTCTTTACAGATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1928s1c1
Sequence:CCGGCATGAAATTCTGTTGGCAGAACTCGAGTTCTGCCAACAGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1763s1c1
Sequence:CCGGCATCTTCACTGTAAAGGAGTTCTCGAGAACTCCTTTACAGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1826s1c1
Sequence:CCGGGCCAGAAGAACACTATGCCATCTCGAGATGGCATAGTGTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2125s21c1
Sequence:CCGGTGTGCCTACTCTAGGGCAAACCTCGAGGTTTGCCCTAGAGTAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2476s21c1
Sequence:CCGGACCTGACCTTCCATCGATATTCTCGAGAATATCGATGGAAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2659s21c1
Sequence:CCGGGTGTAGATCTTAGGTCGTAAACTCGAGTTTACGACCTAAGATCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2177s21c1
Sequence:CCGGTGTAAAGAAGAGAACATGAAACTCGAGTTTCATGTTCTCTTCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-1966s21c1
Sequence:CCGGTCCCACTGTGGCTCTTCACATCTCGAGATGTGAAGAGCCACAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2510s21c1
Sequence:CCGGGTAAGTCCTGAGTGCAGATAGCTCGAGCTATCTGCACTCAGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2075s21c1
Sequence:CCGGAGATGTGGGAACTGGCCAGAACTCGAGTTCTGGCCAGTTCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152392
VALIDATED
AHSA2 MISSION shRNA Lentiviral Transduction Particles
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1728s1c1
Sequence:CCGGGAACTGTTTGACACAACTGTACTCGAGTACAGTTGTGTCAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152392.1-1899s1c1
Sequence:CCGGGAGTTCCTATCTATCTGTAAACTCGAGTTTACAGATAGATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1757s1c1
Sequence:CCGGGTATAGCATCTTCACTGTAAACTCGAGTTTACAGTGAAGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1882s1c1
Sequence:CCGGCAGAATTACAATTGAAGGAGTCTCGAGACTCCTTCAATTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1904s1c1
Sequence:CCGGCCTATCTATCTGTAAAGAAGACTCGAGTCTTCTTTACAGATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1928s1c1
Sequence:CCGGCATGAAATTCTGTTGGCAGAACTCGAGTTCTGCCAACAGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1763s1c1
Sequence:CCGGCATCTTCACTGTAAAGGAGTTCTCGAGAACTCCTTTACAGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152392.1-1826s1c1
Sequence:CCGGGCCAGAAGAACACTATGCCATCTCGAGATGGCATAGTGTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2125s21c1
Sequence:CCGGTGTGCCTACTCTAGGGCAAACCTCGAGGTTTGCCCTAGAGTAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2476s21c1
Sequence:CCGGACCTGACCTTCCATCGATATTCTCGAGAATATCGATGGAAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2659s21c1
Sequence:CCGGGTGTAGATCTTAGGTCGTAAACTCGAGTTTACGACCTAAGATCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2177s21c1
Sequence:CCGGTGTAAAGAAGAGAACATGAAACTCGAGTTTCATGTTCTCTTCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-1966s21c1
Sequence:CCGGTCCCACTGTGGCTCTTCACATCTCGAGATGTGAAGAGCCACAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152392.3-2510s21c1
Sequence:CCGGGTAAGTCCTGAGTGCAGATAGCTCGAGCTATCTGCACTCAGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152392.3-2075s21c1
Sequence:CCGGAGATGTGGGAACTGGCCAGAACTCGAGTTCTGGCCAGTTCCCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172391
VALIDATED
AHSA2 MISSION shRNA Bacterial Glycerol Stock
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-737s1c1
Sequence:CCGGGTACAGTATCTTCACTGTAAACTCGAGTTTACAGTGAAGATACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-294s1c1
Sequence:CCGGGCTTCATGTAACAGCCGCAAACTCGAGTTTGCGGCTGTTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172391.3-1359s1c1
Sequence:CCGGCTTGATTGCTACAATTGATTTCTCGAGAAATCAATTGTAGCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.3-1031s1c1
Sequence:CCGGGAAGCAGCACTTCGAAGAAATCTCGAGATTTCTTCGAAGTGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-550s21c1
Sequence:CCGGAGGCACTCAAGACGGAATTTACTCGAGTAAATTCCGTCTTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-307s21c1
Sequence:CCGGGCCGCAAAGGGAAGCTTATTTCTCGAGAAATAAGCTTCCCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172391.3-2163s21c1
Sequence:CCGGCAAGAATTGAAGCCTATAAATCTCGAGATTTATAGGCTTCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-444s21c1
Sequence:CCGGACTGAGGTGAACGTGAGTAAACTCGAGTTTACTCACGTTCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-951s21c1
Sequence:CCGGGCTCCAGGGCAAACGGAATTACTCGAGTAATTCCGTTTGCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172391
VALIDATED
AHSA2 MISSION shRNA shRNA Plasmid DNA
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-737s1c1
Sequence:CCGGGTACAGTATCTTCACTGTAAACTCGAGTTTACAGTGAAGATACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-294s1c1
Sequence:CCGGGCTTCATGTAACAGCCGCAAACTCGAGTTTGCGGCTGTTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172391.3-1359s1c1
Sequence:CCGGCTTGATTGCTACAATTGATTTCTCGAGAAATCAATTGTAGCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.3-1031s1c1
Sequence:CCGGGAAGCAGCACTTCGAAGAAATCTCGAGATTTCTTCGAAGTGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-550s21c1
Sequence:CCGGAGGCACTCAAGACGGAATTTACTCGAGTAAATTCCGTCTTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-307s21c1
Sequence:CCGGGCCGCAAAGGGAAGCTTATTTCTCGAGAAATAAGCTTCCCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172391.3-2163s21c1
Sequence:CCGGCAAGAATTGAAGCCTATAAATCTCGAGATTTATAGGCTTCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-444s21c1
Sequence:CCGGACTGAGGTGAACGTGAGTAAACTCGAGTTTACTCACGTTCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-951s21c1
Sequence:CCGGGCTCCAGGGCAAACGGAATTACTCGAGTAATTCCGTTTGCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172391
VALIDATED
AHSA2 MISSION shRNA Lentiviral Transduction Particles
AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-737s1c1
Sequence:CCGGGTACAGTATCTTCACTGTAAACTCGAGTTTACAGTGAAGATACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.2-294s1c1
Sequence:CCGGGCTTCATGTAACAGCCGCAAACTCGAGTTTGCGGCTGTTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172391.3-1359s1c1
Sequence:CCGGCTTGATTGCTACAATTGATTTCTCGAGAAATCAATTGTAGCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172391.3-1031s1c1
Sequence:CCGGGAAGCAGCACTTCGAAGAAATCTCGAGATTTCTTCGAAGTGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-550s21c1
Sequence:CCGGAGGCACTCAAGACGGAATTTACTCGAGTAAATTCCGTCTTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-307s21c1
Sequence:CCGGGCCGCAAAGGGAAGCTTATTTCTCGAGAAATAAGCTTCCCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172391.3-2163s21c1
Sequence:CCGGCAAGAATTGAAGCCTATAAATCTCGAGATTTATAGGCTTCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-444s21c1
Sequence:CCGGACTGAGGTGAACGTGAGTAAACTCGAGTTTACTCACGTTCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172391.3-951s21c1
Sequence:CCGGGCTCCAGGGCAAACGGAATTACTCGAGTAATTCCGTTTGCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks