EMAIL THIS PAGE TO A FRIEND

AHSG

alpha-2-HS-glycoprotein

110 Gene Product Result for
Synonyms: A2HS AHS FETUA HSGA
UniProtKB ID: P02765, A8K9N6, B2R7G1, O14961, O14962, Q9P152
Gene ID:
Human(197) Summary: Alpha2-HS glycoprotein (AHSG), a glycoprotein present in the serum, is synthesized by hepatocytes. The AHSG molecule consists of two polypeptide chains, which are both cleaved from a proprotein encoded from a single mRNA. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. The protein is commonly present in the cortical plate of the immature cerebral cortex and bone marrow hemopoietic matrix, and it has therefore been postulated that it participates in the development of the tissues. However, its exact significance is still obscure. [provided by RefSeq, Jul 2008]
Mouse(11625) alpha-2-HS-glycoprotein
Rat(25373) alpha-2-HS-glycoprotein
naked mole-rat(101723028) alpha-2-HS-glycoprotein
domestic guinea pig(100135479) alpha-2-HS-glycoprotein
sheep(443392) alpha-2-HS-glycoprotein
Domestic Rabbit(100009003) alpha-2-HS-glycoprotein
Zebrafish(569558) alpha-2-HS-glycoprotein
dog(607538) alpha-2-HS-glycoprotein
cow(280988) alpha-2-HS-glycoprotein
domestic cat(101099828) alpha-2-HS-glycoprotein
chicken(424956) alpha-2-HS-glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0447 AQUA Peptide HTLNQIDEV[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154851 MISSION® esiRNA esiRNA human AHSG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001622 Rosetta Predictions human pricing
NM_012898 Rosetta Predictions rat pricing
NM_013465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332183 predicted 660
2 SASI_Hs01_00190986 predicted 669
3 SASI_Hs01_00190988 predicted 1283
4 SASI_Hs01_00190989 predicted 715
5 SASI_Hs01_00190990 predicted 424
6 SASI_Hs01_00190991 predicted 1093
7 SASI_Hs01_00190992 predicted 1011
8 SASI_Hs01_00190993 predicted 303
9 SASI_Hs02_00332184 predicted 806
10 SASI_Hs02_00332185 predicted 202
11 SASI_Hs01_00190987 predicted 665
12 SASI_Hs01_00190994 predicted 644
13 SASI_Hs01_00190995 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099079 predicted 206
2 SASI_Rn01_00099080 predicted 1257
3 SASI_Rn01_00099081 predicted 930
4 SASI_Rn02_00260424 predicted 439
5 SASI_Rn01_00099082 predicted 1122
6 SASI_Rn01_00099083 predicted 541
7 SASI_Rn01_00099084 predicted 520
8 SASI_Rn01_00099085 predicted 236
9 SASI_Rn01_00099086 predicted 1181
10 SASI_Rn01_00099087 predicted 1204
11 SASI_Rn01_00099088 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118045 predicted 794
2 SASI_Mm02_00322081 predicted 589
3 SASI_Mm01_00118046 predicted 413
4 SASI_Mm01_00118047 predicted 242
5 SASI_Mm01_00118048 predicted 652
6 SASI_Mm01_00118050 predicted 584
7 SASI_Mm01_00118051 predicted 803
8 SASI_Mm01_00118052 predicted 647
9 SASI_Mm01_00118053 predicted 214
10 SASI_Mm02_00322082 predicted 234
11 SASI_Mm01_00118049 predicted 1192
12 SASI_Mm01_00118054 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001622
AHSG MISSION shRNA Bacterial Glycerol Stock
alpha-2-HS-glycoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1322s21c1
Sequence:CCGGACTCCCTACTTCCCGTCATTCCTCGAGGAATGACGGGAAGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1418s21c1
Sequence:CCGGGACGGTAAGCCACCATGATTGCTCGAGCAATCATGGTGGCTTACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001622.2-261s21c1
Sequence:CCGGGAACCAGATTGATGAAGTAAACTCGAGTTTACTTCATCAATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001622.1-1250s1c1
Sequence:CCGGGCAAGTGTCACATGCGATCTACTCGAGTAGATCGCATGTGACACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-120s1c1
Sequence:CCGGGCTGATTTATAGACAACCGAACTCGAGTTCGGTTGTCTATAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-399s1c1
Sequence:CCGGGCTGTTGAAACTAGATGGCAACTCGAGTTGCCATCTAGTTTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-565s1c1
Sequence:CCGGGCTCAGAACAACGGCTCCAATCTCGAGATTGGAGCCGTTGTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-272s1c1
Sequence:CCGGGAGAGCTGTTTGAGATTGAAACTCGAGTTTCAATCTCAAACAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001622
AHSG MISSION shRNA shRNA Plasmid DNA
alpha-2-HS-glycoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1322s21c1
Sequence:CCGGACTCCCTACTTCCCGTCATTCCTCGAGGAATGACGGGAAGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1418s21c1
Sequence:CCGGGACGGTAAGCCACCATGATTGCTCGAGCAATCATGGTGGCTTACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001622.2-261s21c1
Sequence:CCGGGAACCAGATTGATGAAGTAAACTCGAGTTTACTTCATCAATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001622.1-1250s1c1
Sequence:CCGGGCAAGTGTCACATGCGATCTACTCGAGTAGATCGCATGTGACACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-120s1c1
Sequence:CCGGGCTGATTTATAGACAACCGAACTCGAGTTCGGTTGTCTATAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-399s1c1
Sequence:CCGGGCTGTTGAAACTAGATGGCAACTCGAGTTGCCATCTAGTTTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-565s1c1
Sequence:CCGGGCTCAGAACAACGGCTCCAATCTCGAGATTGGAGCCGTTGTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-272s1c1
Sequence:CCGGGAGAGCTGTTTGAGATTGAAACTCGAGTTTCAATCTCAAACAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001622
AHSG MISSION shRNA Lentiviral Transduction Particles
alpha-2-HS-glycoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1322s21c1
Sequence:CCGGACTCCCTACTTCCCGTCATTCCTCGAGGAATGACGGGAAGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001622.2-1418s21c1
Sequence:CCGGGACGGTAAGCCACCATGATTGCTCGAGCAATCATGGTGGCTTACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001622.2-261s21c1
Sequence:CCGGGAACCAGATTGATGAAGTAAACTCGAGTTTACTTCATCAATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001622.1-1250s1c1
Sequence:CCGGGCAAGTGTCACATGCGATCTACTCGAGTAGATCGCATGTGACACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-120s1c1
Sequence:CCGGGCTGATTTATAGACAACCGAACTCGAGTTCGGTTGTCTATAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-399s1c1
Sequence:CCGGGCTGTTGAAACTAGATGGCAACTCGAGTTGCCATCTAGTTTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-565s1c1
Sequence:CCGGGCTCAGAACAACGGCTCCAATCTCGAGATTGGAGCCGTTGTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001622.1-272s1c1
Sequence:CCGGGAGAGCTGTTTGAGATTGAAACTCGAGTTTCAATCTCAAACAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013465
AHSG MISSION shRNA Bacterial Glycerol Stock
alpha-2-HS-glycoprotein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013465.1-1257s1c1
Sequence:CCGGGCAGAGAGGTAATGGTCAAATCTCGAGATTTGACCATTACCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-581s1c1
Sequence:CCGGGCCTTCAACACACAGAATAATCTCGAGATTATTCTGTGTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-248s1c1
Sequence:CCGGGTCTTGAATCAGATCGACAAACTCGAGTTTGTCGATCTGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-578s1c1
Sequence:CCGGGCTGCCTTCAACACACAGAATCTCGAGATTCTGTGTGTTGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-203s1c1
Sequence:CCGGGCCGTGGACTACCTCAATAATCTCGAGATTATTGAGGTAGTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013465.1-225s21c1
Sequence:CCGGATCTTCTTCAGGGATTCAAACCTCGAGGTTTGAATCCCTGAAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013465
AHSG MISSION shRNA shRNA Plasmid DNA
alpha-2-HS-glycoprotein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013465.1-1257s1c1
Sequence:CCGGGCAGAGAGGTAATGGTCAAATCTCGAGATTTGACCATTACCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-581s1c1
Sequence:CCGGGCCTTCAACACACAGAATAATCTCGAGATTATTCTGTGTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-248s1c1
Sequence:CCGGGTCTTGAATCAGATCGACAAACTCGAGTTTGTCGATCTGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-578s1c1
Sequence:CCGGGCTGCCTTCAACACACAGAATCTCGAGATTCTGTGTGTTGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-203s1c1
Sequence:CCGGGCCGTGGACTACCTCAATAATCTCGAGATTATTGAGGTAGTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013465.1-225s21c1
Sequence:CCGGATCTTCTTCAGGGATTCAAACCTCGAGGTTTGAATCCCTGAAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013465
AHSG MISSION shRNA Lentiviral Transduction Particles
alpha-2-HS-glycoprotein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013465.1-1257s1c1
Sequence:CCGGGCAGAGAGGTAATGGTCAAATCTCGAGATTTGACCATTACCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-581s1c1
Sequence:CCGGGCCTTCAACACACAGAATAATCTCGAGATTATTCTGTGTGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-248s1c1
Sequence:CCGGGTCTTGAATCAGATCGACAAACTCGAGTTTGTCGATCTGATTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-578s1c1
Sequence:CCGGGCTGCCTTCAACACACAGAATCTCGAGATTCTGTGTGTTGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013465.1-203s1c1
Sequence:CCGGGCCGTGGACTACCTCAATAATCTCGAGATTATTGAGGTAGTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013465.1-225s21c1
Sequence:CCGGATCTTCTTCAGGGATTCAAACCTCGAGGTTTGAATCCCTGAAGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks