EMAIL THIS PAGE TO A FRIEND

AHSP

alpha hemoglobin stabilizing protein

48 Gene Product Result for
Synonyms: EDRF ERAF
UniProtKB ID: Q9NZD4, Q8TD01
Gene ID:
Mouse(170812) alpha hemoglobin stabilizing protein
Rat(293522) alpha hemoglobin stabilizing protein
cow(338381) alpha hemoglobin stabilizing protein
domestic cat(101081350) alpha hemoglobin stabilizing protein
dog(100686586) alpha hemoglobin stabilizing protein
sheep(100127218) alpha hemoglobin stabilizing protein
domestic guinea pig(100712877) alpha hemoglobin stabilizing protein
naked mole-rat(101723868) alpha hemoglobin stabilizing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000201 MISSION® esiRNA esiRNA targeting human ERAF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016633 Rosetta Predictions human pricing
NM_001106299 Rosetta Predictions rat pricing
NM_133245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089409 predicted 213
2 SASI_Hs01_00089410 predicted 208
3 SASI_Hs01_00089411 predicted 276
4 SASI_Hs01_00089412 predicted 216
5 SASI_Hs01_00089413 predicted 215
6 SASI_Hs01_00089414 predicted 216
7 SASI_Hs01_00089415 predicted 262
8 SASI_Hs01_00089416 predicted 234
9 SASI_Hs01_00089417 predicted 215
10 SASI_Hs01_00089418 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217608 predicted 264
2 SASI_Rn02_00217609 predicted 222
3 SASI_Rn02_00217610 predicted 204
4 SASI_Rn02_00217611 predicted 253
5 SASI_Rn02_00217612 predicted 261
6 SASI_Rn02_00217613 predicted 243
7 SASI_Rn02_00217614 predicted 255
8 SASI_Rn02_00217615 predicted 238
9 SASI_Rn02_00217616 predicted 244
10 SASI_Rn02_00217617 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020001 predicted 199
2 SASI_Mm02_00338497 predicted 244
3 SASI_Mm01_00020002 predicted 195
4 SASI_Mm01_00020003 predicted 260
5 SASI_Mm01_00020004 predicted 262
6 SASI_Mm01_00020006 predicted 270
7 SASI_Mm01_00020007 predicted 258
8 SASI_Mm01_00020008 predicted 254
9 SASI_Mm01_00020009 predicted 209
10 SASI_Mm02_00338498 predicted 247
11 SASI_Mm01_00020005 predicted 202
12 SASI_Mm01_00020010 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016633
AHSP MISSION shRNA Bacterial Glycerol Stock
alpha hemoglobin stabilizing protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-214s1c1
Sequence:CCGGCTGGATGAACTTCTACATCAACTCGAGTTGATGTAGAAGTTCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-149s1c1
Sequence:CCGGCTGAATCAGCAGGTCTTCAATCTCGAGATTGAAGACCTGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-232s1c1
Sequence:CCGGCAACTATTACAGGCAGCAGGTCTCGAGACCTGCTGCCTGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-175s1c1
Sequence:CCGGTCTCGTCTCTGAAGAAGACATCTCGAGATGTCTTCTTCAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-341s1c1
Sequence:CCGGAGGGACTTCCTGAAGTCTCATCTCGAGATGAGACTTCAGGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016633
AHSP MISSION shRNA shRNA Plasmid DNA
alpha hemoglobin stabilizing protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-214s1c1
Sequence:CCGGCTGGATGAACTTCTACATCAACTCGAGTTGATGTAGAAGTTCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-149s1c1
Sequence:CCGGCTGAATCAGCAGGTCTTCAATCTCGAGATTGAAGACCTGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-232s1c1
Sequence:CCGGCAACTATTACAGGCAGCAGGTCTCGAGACCTGCTGCCTGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-175s1c1
Sequence:CCGGTCTCGTCTCTGAAGAAGACATCTCGAGATGTCTTCTTCAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-341s1c1
Sequence:CCGGAGGGACTTCCTGAAGTCTCATCTCGAGATGAGACTTCAGGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016633
AHSP MISSION shRNA Lentiviral Transduction Particles
alpha hemoglobin stabilizing protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-214s1c1
Sequence:CCGGCTGGATGAACTTCTACATCAACTCGAGTTGATGTAGAAGTTCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-149s1c1
Sequence:CCGGCTGAATCAGCAGGTCTTCAATCTCGAGATTGAAGACCTGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-232s1c1
Sequence:CCGGCAACTATTACAGGCAGCAGGTCTCGAGACCTGCTGCCTGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-175s1c1
Sequence:CCGGTCTCGTCTCTGAAGAAGACATCTCGAGATGTCTTCTTCAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016633.2-341s1c1
Sequence:CCGGAGGGACTTCCTGAAGTCTCATCTCGAGATGAGACTTCAGGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133245
AHSP MISSION shRNA Bacterial Glycerol Stock
alpha hemoglobin stabilizing protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-103s1c1
Sequence:CCGGCCACAGGGATAAAGGAGTTTACTCGAGTAAACTCCTTTATCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-203s1c1
Sequence:CCGGGAACTTGTACACCAACTATTACTCGAGTAATAGTTGGTGTACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-174s1c1
Sequence:CCGGGACATGGTGATTGTGGTTCATCTCGAGATGAACCACAATCACCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-105s1c1
Sequence:CCGGACAGGGATAAAGGAGTTTAATCTCGAGATTAAACTCCTTTATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-304s1c1
Sequence:CCGGGCCAGTTTCTAGCCAAATACACTCGAGTGTATTTGGCTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133245
AHSP MISSION shRNA shRNA Plasmid DNA
alpha hemoglobin stabilizing protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-103s1c1
Sequence:CCGGCCACAGGGATAAAGGAGTTTACTCGAGTAAACTCCTTTATCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-203s1c1
Sequence:CCGGGAACTTGTACACCAACTATTACTCGAGTAATAGTTGGTGTACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-174s1c1
Sequence:CCGGGACATGGTGATTGTGGTTCATCTCGAGATGAACCACAATCACCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-105s1c1
Sequence:CCGGACAGGGATAAAGGAGTTTAATCTCGAGATTAAACTCCTTTATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-304s1c1
Sequence:CCGGGCCAGTTTCTAGCCAAATACACTCGAGTGTATTTGGCTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133245
AHSP MISSION shRNA Lentiviral Transduction Particles
alpha hemoglobin stabilizing protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-103s1c1
Sequence:CCGGCCACAGGGATAAAGGAGTTTACTCGAGTAAACTCCTTTATCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-203s1c1
Sequence:CCGGGAACTTGTACACCAACTATTACTCGAGTAATAGTTGGTGTACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-174s1c1
Sequence:CCGGGACATGGTGATTGTGGTTCATCTCGAGATGAACCACAATCACCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-105s1c1
Sequence:CCGGACAGGGATAAAGGAGTTTAATCTCGAGATTAAACTCCTTTATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133245.1-304s1c1
Sequence:CCGGGCCAGTTTCTAGCCAAATACACTCGAGTGTATTTGGCTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks