EMAIL THIS PAGE TO A FRIEND

AICDA

activation-induced cytidine deaminase

Synonyms: AID ARP2 CDA2 HIGM2
UniProtKB ID: Q9GZX7
Gene ID:
Human(57379) Summary: This gene encodes a RNA-editing deaminase that is a member of the cytidine deaminase family. The protein is involved in somatic hypermutation, gene conversion, and class-switch recombination of immunoglobulin genes. Defects in this gene are the cause of autosomal recessive hyper-IgM immunodeficiency syndrome type 2 (HIGM2). [provided by RefSeq, Feb 2009]
Mouse(11628) activation-induced cytidine deaminase
Rat(399679) activation-induced cytidine deaminase
Zebrafish(493784) activation-induced cytidine deaminase
dog(442983) activation-induced cytidine deaminase
cow(539888) activation-induced cytidine deaminase
domestic cat(101101143) activation-induced cytidine deaminase
chicken(418257) activation-induced cytidine deaminase
naked mole-rat(101723465) activation-induced cytidine deaminase
domestic guinea pig(100729642) activation-induced cytidine deaminase
sheep(101103056) activation-induced cytidine deaminase
Domestic Rabbit(100008969) activation-induced cytidine deaminase
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020661 Rosetta Predictions human pricing
XM_001060382 Rosetta Predictions rat pricing
XM_575660 Rosetta Predictions rat pricing
NM_009645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353645 predicted 732
2 SASI_Hs02_00353646 predicted 478
3 SASI_Hs01_00125516 predicted 679
4 SASI_Hs02_00353647 predicted 738
5 SASI_Hs01_00125517 predicted 1113
6 SASI_Hs01_00125518 predicted 207
7 SASI_Hs01_00125519 predicted 1172
8 SASI_Hs01_00125520 predicted 684
9 SASI_Hs01_00125521 predicted 199
10 SASI_Hs02_00353648 predicted 473
11 SASI_Hs01_00125514 predicted 628
12 SASI_Hs01_00125515 predicted 1122
13 SASI_Hs01_00125522 predicted 668
14 SASI_Hs01_00125523 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296318 predicted 383
2 SASI_Rn02_00296319 predicted 429
3 SASI_Rn02_00296320 predicted 425
4 SASI_Rn02_00296321 predicted 256
5 SASI_Rn02_00296322 predicted 368
6 SASI_Rn02_00296323 predicted 365
7 SASI_Rn02_00296324 predicted 198
8 SASI_Rn02_00296325 predicted 203
9 SASI_Rn02_00296326 predicted 321
10 SASI_Rn02_00296327 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404037 predicted 383
2 SASI_Rn02_00404038 predicted 433
3 SASI_Rn02_00404039 predicted 429
4 SASI_Rn02_00404040 predicted 256
5 SASI_Rn02_00404041 predicted 372
6 SASI_Rn02_00404042 predicted 365
7 SASI_Rn02_00404043 predicted 205
8 SASI_Rn02_00404044 predicted 202
9 SASI_Rn02_00404045 predicted 328
10 SASI_Rn02_00404046 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177408 predicted 663
2 SASI_Mm02_00316629 predicted 695
3 SASI_Mm02_00316630 predicted 565
4 SASI_Mm01_00177409 predicted 394
5 SASI_Mm01_00177410 predicted 633
6 SASI_Mm01_00177412 predicted 254
7 SASI_Mm01_00177413 predicted 709
8 SASI_Mm01_00177414 predicted 199
9 SASI_Mm01_00177415 predicted 529
10 SASI_Mm01_00177416 predicted 686
11 SASI_Mm01_00177411 predicted 695
12 SASI_Mm01_00177417 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020661
AICDA MISSION shRNA Bacterial Glycerol Stock
activation-induced cytidine deaminase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000424739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020661.2-1015s21c1
Sequence:CCGGAGCATGGTGAGAGGATCAAATCTCGAGATTTGATCCTCTCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020661.2-540s21c1
Sequence:CCGGACCACGAAAGAACTTTCAAAGCTCGAGCTTTGAAAGTTCTTTCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020661.1-651s1c1
Sequence:CCGGCATTTCGTACTTTGGGACTTTCTCGAGAAAGTCCCAAAGTACGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020661
AICDA MISSION shRNA shRNA Plasmid DNA
activation-induced cytidine deaminase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000424739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020661.2-1015s21c1
Sequence:CCGGAGCATGGTGAGAGGATCAAATCTCGAGATTTGATCCTCTCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020661.2-540s21c1
Sequence:CCGGACCACGAAAGAACTTTCAAAGCTCGAGCTTTGAAAGTTCTTTCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020661.1-651s1c1
Sequence:CCGGCATTTCGTACTTTGGGACTTTCTCGAGAAAGTCCCAAAGTACGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020661
AICDA MISSION shRNA Lentiviral Transduction Particles
activation-induced cytidine deaminase
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000424739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020661.2-1015s21c1
Sequence:CCGGAGCATGGTGAGAGGATCAAATCTCGAGATTTGATCCTCTCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020661.2-540s21c1
Sequence:CCGGACCACGAAAGAACTTTCAAAGCTCGAGCTTTGAAAGTTCTTTCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020661.1-651s1c1
Sequence:CCGGCATTTCGTACTTTGGGACTTTCTCGAGAAAGTCCCAAAGTACGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009645
AICDA MISSION shRNA Bacterial Glycerol Stock
activation-induced cytidine deaminase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009645.1-1452s1c1
Sequence:CCGGCGTCCCTTAAACATCAGTAATCTCGAGATTACTGATGTTTAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-645s1c1
Sequence:CCGGGAAGTCGATGACTTGCGAGATCTCGAGATCTCGCAAGTCATCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-258s1c1
Sequence:CCGGCACGTGGAATTGTTGTTCCTACTCGAGTAGGAACAACAATTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-506s1c1
Sequence:CCGGCATGACCTTCAAAGACTATTTCTCGAGAAATAGTCTTTGAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-659s1c1
Sequence:CCGGGCGAGATGCATTTCGTATGTTCTCGAGAACATACGAAATGCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009645
AICDA MISSION shRNA shRNA Plasmid DNA
activation-induced cytidine deaminase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009645.1-1452s1c1
Sequence:CCGGCGTCCCTTAAACATCAGTAATCTCGAGATTACTGATGTTTAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-645s1c1
Sequence:CCGGGAAGTCGATGACTTGCGAGATCTCGAGATCTCGCAAGTCATCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-258s1c1
Sequence:CCGGCACGTGGAATTGTTGTTCCTACTCGAGTAGGAACAACAATTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-506s1c1
Sequence:CCGGCATGACCTTCAAAGACTATTTCTCGAGAAATAGTCTTTGAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-659s1c1
Sequence:CCGGGCGAGATGCATTTCGTATGTTCTCGAGAACATACGAAATGCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009645
AICDA MISSION shRNA Lentiviral Transduction Particles
activation-induced cytidine deaminase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009645.1-1452s1c1
Sequence:CCGGCGTCCCTTAAACATCAGTAATCTCGAGATTACTGATGTTTAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-645s1c1
Sequence:CCGGGAAGTCGATGACTTGCGAGATCTCGAGATCTCGCAAGTCATCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-258s1c1
Sequence:CCGGCACGTGGAATTGTTGTTCCTACTCGAGTAGGAACAACAATTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-506s1c1
Sequence:CCGGCATGACCTTCAAAGACTATTTCTCGAGAAATAGTCTTTGAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009645.1-659s1c1
Sequence:CCGGGCGAGATGCATTTCGTATGTTCTCGAGAACATACGAAATGCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks