EMAIL THIS PAGE TO A FRIEND

AIDA

axin interactor, dorsalization associated

97 Gene Product Result for
Synonyms: C1orf80 RP11-378J18.7
UniProtKB ID: Q96BJ3, A8K1F0, Q49A81, Q5JRA4, Q658P1, Q9H9E8
Gene ID:
Mouse(108909) axin interactor, dorsalization associated
Rat(682999) axin interactor, dorsalization associated
sheep(101106862) axin interactor, dorsalization associated
domestic guinea pig(100727698) axin interactor, dorsalization associated
naked mole-rat(101716721) axin interactor, dorsalization associated
Zebrafish(393763) axin interaction partner and dorsalization antagonist
dog(607802) axin interactor, dorsalization associated
cow(508353) axin interactor, dorsalization associated
domestic cat(101097783) axin interactor, dorsalization associated
chicken(421335) axin interactor, dorsalization associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022831 Rosetta Predictions human pricing
NM_001127600 Rosetta Predictions rat pricing
NM_145626 Rosetta Predictions mouse pricing
NM_181732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356136 predicted 701
2 SASI_Hs02_00356137 predicted 697
3 SASI_Hs02_00356138 predicted 710
4 SASI_Hs02_00356139 predicted 757
5 SASI_Hs02_00356140 predicted 479
6 SASI_Hs02_00356141 predicted 764
7 SASI_Hs02_00356142 predicted 690
8 SASI_Hs02_00356143 predicted 495
9 SASI_Hs02_00356144 predicted 288
10 SASI_Hs02_00356145 predicted 354
11 SASI_Hs01_00112443 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254600 predicted 641
2 SASI_Rn02_00254601 predicted 943
3 SASI_Rn02_00254602 predicted 426
4 SASI_Rn02_00254603 predicted 635
5 SASI_Rn02_00254604 predicted 911
6 SASI_Rn02_00254605 predicted 1012
7 SASI_Rn02_00254606 predicted 957
8 SASI_Rn02_00254607 predicted 1039
9 SASI_Rn02_00254608 predicted 518
10 SASI_Rn02_00254609 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179291 predicted 1072
2 SASI_Mm01_00179292 predicted 282
3 SASI_Mm01_00179293 predicted 418
4 SASI_Mm01_00179294 predicted 1011
5 SASI_Mm01_00179295 predicted 1058
6 SASI_Mm01_00179296 predicted 287
7 SASI_Mm01_00179297 predicted 939
8 SASI_Mm01_00179298 predicted 929
9 SASI_Mm01_00179299 predicted 231
10 SASI_Mm01_00179300 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061596 predicted 1474
2 SASI_Mm01_00061597 predicted 797
3 SASI_Mm02_00349897 predicted 776
4 SASI_Mm01_00061598 predicted 1087
5 SASI_Mm02_00349898 predicted 773
6 SASI_Mm02_00349899 predicted 1324
7 SASI_Mm01_00061600 predicted 1133
8 SASI_Mm02_00349900 predicted 1024
9 SASI_Mm02_00349901 predicted 679
10 SASI_Mm01_00061599 predicted 1390
11 SASI_Mm01_00061601 predicted 1441
12 SASI_Mm01_00061602 predicted 1323
13 SASI_Mm01_00061603 predicted 1304
14 SASI_Mm01_00061604 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022831
VALIDATED
AIDA MISSION shRNA Bacterial Glycerol Stock
axin interactor, dorsalization associated
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-716s1c1
Sequence:CCGGCCCTATATTACAGTTAGTGTACTCGAGTACACTAACTGTAATATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-2105s1c1
Sequence:CCGGGCAGGTCATTAGCTTACTATACTCGAGTATAGTAAGCTAATGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-368s1c1
Sequence:CCGGGAATTGCGAAGTGCAGCTTTACTCGAGTAAAGCTGCACTTCGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022831.1-1640s1c1
Sequence:CCGGCCTGCTTAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1080s1c1
Sequence:CCGGCCTGACATGATGAACCTGGAACTCGAGTTCCAGGTTCATCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-248s1c1
Sequence:CCGGGCGATAGACGAGTATCAGATACTCGAGTATCTGATACTCGTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1771s1c1
Sequence:CCGGGCTGTTCTTCTACATCACATTCTCGAGAATGTGATGTAGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-648s1c1
Sequence:CCGGCAGGAATGACATTACTCACTACTCGAGTAGTGAGTAATGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-537s21c1
Sequence:CCGGATGTTCAGCCTGTCCCATTAACTCGAGTTAATGGGACAGGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022831.2-2366s21c1
Sequence:CCGGGTGTAATCACCCTAGTCATACCTCGAGGTATGACTAGGGTGATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-689s21c1
Sequence:CCGGTCGGAACCAGGAATGACATTACTCGAGTAATGTCATTCCTGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-341s21c1
Sequence:CCGGGCCCAAGCTCAACACAATAATCTCGAGATTATTGTGTTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-445s21c1
Sequence:CCGGACAGTCTCAAGAAGAATTTAACTCGAGTTAAATTCTTCTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-789s21c1
Sequence:CCGGATCTGAATGGCATAGACTTAACTCGAGTTAAGTCTATGCCATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-2215s21c1
Sequence:CCGGGTACACATGAGGTGGATATTTCTCGAGAAATATCCACCTCATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-653s21c1
Sequence:CCGGGCTAGAGTTCCCGGTACTTTACTCGAGTAAAGTACCGGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-481s21c1
Sequence:CCGGGAAGCTAGAACCAATCCTAAACTCGAGTTTAGGATTGGTTCTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-1012s21c1
Sequence:CCGGGCCAATTGTAATAGAACTATACTCGAGTATAGTTCTATTACAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022831
VALIDATED
AIDA MISSION shRNA shRNA Plasmid DNA
axin interactor, dorsalization associated
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-716s1c1
Sequence:CCGGCCCTATATTACAGTTAGTGTACTCGAGTACACTAACTGTAATATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-2105s1c1
Sequence:CCGGGCAGGTCATTAGCTTACTATACTCGAGTATAGTAAGCTAATGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-368s1c1
Sequence:CCGGGAATTGCGAAGTGCAGCTTTACTCGAGTAAAGCTGCACTTCGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022831.1-1640s1c1
Sequence:CCGGCCTGCTTAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1080s1c1
Sequence:CCGGCCTGACATGATGAACCTGGAACTCGAGTTCCAGGTTCATCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-248s1c1
Sequence:CCGGGCGATAGACGAGTATCAGATACTCGAGTATCTGATACTCGTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1771s1c1
Sequence:CCGGGCTGTTCTTCTACATCACATTCTCGAGAATGTGATGTAGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-648s1c1
Sequence:CCGGCAGGAATGACATTACTCACTACTCGAGTAGTGAGTAATGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-537s21c1
Sequence:CCGGATGTTCAGCCTGTCCCATTAACTCGAGTTAATGGGACAGGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022831.2-2366s21c1
Sequence:CCGGGTGTAATCACCCTAGTCATACCTCGAGGTATGACTAGGGTGATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-689s21c1
Sequence:CCGGTCGGAACCAGGAATGACATTACTCGAGTAATGTCATTCCTGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-341s21c1
Sequence:CCGGGCCCAAGCTCAACACAATAATCTCGAGATTATTGTGTTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-445s21c1
Sequence:CCGGACAGTCTCAAGAAGAATTTAACTCGAGTTAAATTCTTCTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-789s21c1
Sequence:CCGGATCTGAATGGCATAGACTTAACTCGAGTTAAGTCTATGCCATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-2215s21c1
Sequence:CCGGGTACACATGAGGTGGATATTTCTCGAGAAATATCCACCTCATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-653s21c1
Sequence:CCGGGCTAGAGTTCCCGGTACTTTACTCGAGTAAAGTACCGGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-481s21c1
Sequence:CCGGGAAGCTAGAACCAATCCTAAACTCGAGTTTAGGATTGGTTCTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-1012s21c1
Sequence:CCGGGCCAATTGTAATAGAACTATACTCGAGTATAGTTCTATTACAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022831
VALIDATED
AIDA MISSION shRNA Lentiviral Transduction Particles
axin interactor, dorsalization associated
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-716s1c1
Sequence:CCGGCCCTATATTACAGTTAGTGTACTCGAGTACACTAACTGTAATATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-2105s1c1
Sequence:CCGGGCAGGTCATTAGCTTACTATACTCGAGTATAGTAAGCTAATGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-368s1c1
Sequence:CCGGGAATTGCGAAGTGCAGCTTTACTCGAGTAAAGCTGCACTTCGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022831.1-1640s1c1
Sequence:CCGGCCTGCTTAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1080s1c1
Sequence:CCGGCCTGACATGATGAACCTGGAACTCGAGTTCCAGGTTCATCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022831.1-248s1c1
Sequence:CCGGGCGATAGACGAGTATCAGATACTCGAGTATCTGATACTCGTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022831.1-1771s1c1
Sequence:CCGGGCTGTTCTTCTACATCACATTCTCGAGAATGTGATGTAGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022831.1-648s1c1
Sequence:CCGGCAGGAATGACATTACTCACTACTCGAGTAGTGAGTAATGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-537s21c1
Sequence:CCGGATGTTCAGCCTGTCCCATTAACTCGAGTTAATGGGACAGGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022831.2-2366s21c1
Sequence:CCGGGTGTAATCACCCTAGTCATACCTCGAGGTATGACTAGGGTGATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-689s21c1
Sequence:CCGGTCGGAACCAGGAATGACATTACTCGAGTAATGTCATTCCTGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-341s21c1
Sequence:CCGGGCCCAAGCTCAACACAATAATCTCGAGATTATTGTGTTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-445s21c1
Sequence:CCGGACAGTCTCAAGAAGAATTTAACTCGAGTTAAATTCTTCTTGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-789s21c1
Sequence:CCGGATCTGAATGGCATAGACTTAACTCGAGTTAAGTCTATGCCATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-2215s21c1
Sequence:CCGGGTACACATGAGGTGGATATTTCTCGAGAAATATCCACCTCATGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-653s21c1
Sequence:CCGGGCTAGAGTTCCCGGTACTTTACTCGAGTAAAGTACCGGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-481s21c1
Sequence:CCGGGAAGCTAGAACCAATCCTAAACTCGAGTTTAGGATTGGTTCTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022831.2-1012s21c1
Sequence:CCGGGCCAATTGTAATAGAACTATACTCGAGTATAGTTCTATTACAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145626
VALIDATED
AIDA MISSION shRNA Bacterial Glycerol Stock
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145626.1-718s1c1
Sequence:CCGGGATACTTACGTCCACTTTAATCTCGAGATTAAAGTGGACGTAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-973s1c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145626.1-278s1c1
Sequence:CCGGCGACATGTTTGGAATTGCGTACTCGAGTACGCAATTCCAAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1446s1c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1650s1c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145626
VALIDATED
AIDA MISSION shRNA shRNA Plasmid DNA
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145626.1-718s1c1
Sequence:CCGGGATACTTACGTCCACTTTAATCTCGAGATTAAAGTGGACGTAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-973s1c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145626.1-278s1c1
Sequence:CCGGCGACATGTTTGGAATTGCGTACTCGAGTACGCAATTCCAAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1446s1c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1650s1c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145626
VALIDATED
AIDA MISSION shRNA Lentiviral Transduction Particles
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145626.1-718s1c1
Sequence:CCGGGATACTTACGTCCACTTTAATCTCGAGATTAAAGTGGACGTAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-973s1c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145626.1-278s1c1
Sequence:CCGGCGACATGTTTGGAATTGCGTACTCGAGTACGCAATTCCAAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1446s1c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145626.1-1650s1c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181732
VALIDATED
AIDA MISSION shRNA Bacterial Glycerol Stock
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1354s21c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-2059s21c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-800s21c1
Sequence:CCGGCTATTCCATTAAGACGTATTTCTCGAGAAATACGTCTTAATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1855s21c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-904s21c1
Sequence:CCGGGCTAGAGTTCCTGGTACTTTACTCGAGTAAAGTACCAGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181732
VALIDATED
AIDA MISSION shRNA shRNA Plasmid DNA
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1354s21c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-2059s21c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-800s21c1
Sequence:CCGGCTATTCCATTAAGACGTATTTCTCGAGAAATACGTCTTAATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1855s21c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-904s21c1
Sequence:CCGGGCTAGAGTTCCTGGTACTTTACTCGAGTAAAGTACCAGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181732
VALIDATED
AIDA MISSION shRNA Lentiviral Transduction Particles
axin interactor, dorsalization associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1354s21c1
Sequence:CCGGCATCAAAGTTTGCACAAGGAACTCGAGTTCCTTGTGCAAACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-2059s21c1
Sequence:CCGGCGTTGGAACCATCTCAGAATACTCGAGTATTCTGAGATGGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-800s21c1
Sequence:CCGGCTATTCCATTAAGACGTATTTCTCGAGAAATACGTCTTAATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-1855s21c1
Sequence:CCGGCCTAGCAAAGTCTCCTTAGAACTCGAGTTCTAAGGAGACTTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181732.4-904s21c1
Sequence:CCGGGCTAGAGTTCCTGGTACTTTACTCGAGTAAAGTACCAGGAACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks