EMAIL THIS PAGE TO A FRIEND

AIF1

allograft inflammatory factor 1

82 Gene Product Result for
Synonyms: AIF-1 IBA1 IRT-1 IRT1
UniProtKB ID: P55008, A8K406, O43904, Q9UIV4, Q9UKS9
Gene ID:
Human(199) Summary: This gene is induced by cytokines and interferon. Its protein product is thought to be involved in negative regulation of growth of vascular smooth muscle cells, which contributes to the anti-inflammatory response to vessel wall trauma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(11629) allograft inflammatory factor 1
Rat(29427) allograft inflammatory factor 1
Thale Cress(819749) activation-tagged BRI1 suppressor 1-interacting factor 1
dog(474841) allograft inflammatory factor 1
cow(280989) allograft inflammatory factor 1
domestic cat(101085631) allograft inflammatory factor 1
naked mole-rat(101713928) allograft inflammatory factor 1
domestic guinea pig(100722276) allograft inflammatory factor 1
Goat(100860979) allograft inflammatory factor 1
sheep(101121889) allograft inflammatory factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001623 Rosetta Predictions human pricing
NM_004847 Rosetta Predictions human pricing
NM_032955 Rosetta Predictions human pricing
NM_017196 Rosetta Predictions rat pricing
NM_019467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074683 predicted 321
2 SASI_Hs01_00074684 predicted 312
3 SASI_Hs01_00074685 predicted 248
4 SASI_Hs01_00074686 predicted 238
5 SASI_Hs01_00074687 predicted 228
6 SASI_Hs01_00074688 predicted 264
7 SASI_Hs01_00074689 predicted 327
8 SASI_Hs01_00074690 predicted 248
9 SASI_Hs01_00074691 predicted 255
10 SASI_Hs01_00074692 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110108 predicted 795
2 SASI_Hs01_00110109 predicted 545
3 SASI_Hs01_00110110 predicted 731
4 SASI_Hs01_00110111 predicted 520
5 SASI_Hs01_00110112 predicted 681
6 SASI_Hs01_00110113 predicted 557
7 SASI_Hs01_00110114 predicted 754
8 SASI_Hs01_00110115 predicted 558
9 SASI_Hs01_00110116 predicted 789
10 SASI_Hs01_00110117 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242608 predicted 228
2 SASI_Hs01_00242609 predicted 225
3 SASI_Hs01_00242610 predicted 234
4 SASI_Hs01_00242611 predicted 270
5 SASI_Hs01_00242612 predicted 227
6 SASI_Hs01_00242613 predicted 245
7 SASI_Hs01_00242614 predicted 267
8 SASI_Hs01_00242615 predicted 274
9 SASI_Hs01_00242616 predicted 242
10 SASI_Hs01_00242617 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086425 predicted 405
2 SASI_Rn01_00086426 predicted 271
3 SASI_Rn01_00086427 predicted 261
4 SASI_Rn01_00086428 predicted 241
5 SASI_Rn02_00261551 predicted 254
6 SASI_Rn01_00086429 predicted 396
7 SASI_Rn01_00086430 predicted 433
8 SASI_Rn01_00086431 predicted 252
9 SASI_Rn01_00086432 predicted 384
10 SASI_Rn01_00086433 predicted 276
11 SASI_Rn01_00086434 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190259 predicted 622
2 SASI_Mm01_00190260 predicted 563
3 SASI_Mm01_00190261 predicted 651
4 SASI_Mm01_00190262 predicted 438
5 SASI_Mm01_00190263 predicted 566
6 SASI_Mm01_00190265 predicted 319
7 SASI_Mm01_00190266 predicted 487
8 SASI_Mm01_00190267 predicted 477
9 SASI_Mm02_00324470 predicted 478
10 SASI_Mm01_00190268 predicted 557
11 SASI_Mm01_00190264 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001623
AIF1 MISSION shRNA Bacterial Glycerol Stock
allograft inflammatory factor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001623.3-373s21c1
Sequence:CCGGCGTTCAGCTACCCTGACTTTCCTCGAGGAAAGTCAGGGTAGCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-248s1c1
Sequence:CCGGCCTTAATGGAAATGGCGATATCTCGAGATATCGCCATTTCCATTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-162s1c1
Sequence:CCGGCAATTCCTAGACGATCCCAAACTCGAGTTTGGGATCGTCTAGGAATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-486s1c1
Sequence:CCGGCCAGCCAAGAAAGCTATCTCTCTCGAGAGAGATAGCTTTCTTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-409s1c1
Sequence:CCGGGCAAGAGATCTGCCATCCTAACTCGAGTTAGGATGGCAGATCTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-281s1c1
Sequence:CCGGCCTGAAACGAATGCTGGAGAACTCGAGTTCTCCAGCATTCGTTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001623
AIF1 MISSION shRNA shRNA Plasmid DNA
allograft inflammatory factor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001623.3-373s21c1
Sequence:CCGGCGTTCAGCTACCCTGACTTTCCTCGAGGAAAGTCAGGGTAGCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-248s1c1
Sequence:CCGGCCTTAATGGAAATGGCGATATCTCGAGATATCGCCATTTCCATTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-162s1c1
Sequence:CCGGCAATTCCTAGACGATCCCAAACTCGAGTTTGGGATCGTCTAGGAATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-486s1c1
Sequence:CCGGCCAGCCAAGAAAGCTATCTCTCTCGAGAGAGATAGCTTTCTTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-409s1c1
Sequence:CCGGGCAAGAGATCTGCCATCCTAACTCGAGTTAGGATGGCAGATCTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-281s1c1
Sequence:CCGGCCTGAAACGAATGCTGGAGAACTCGAGTTCTCCAGCATTCGTTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001623
AIF1 MISSION shRNA Lentiviral Transduction Particles
allograft inflammatory factor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001623.3-373s21c1
Sequence:CCGGCGTTCAGCTACCCTGACTTTCCTCGAGGAAAGTCAGGGTAGCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-248s1c1
Sequence:CCGGCCTTAATGGAAATGGCGATATCTCGAGATATCGCCATTTCCATTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-162s1c1
Sequence:CCGGCAATTCCTAGACGATCCCAAACTCGAGTTTGGGATCGTCTAGGAATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-486s1c1
Sequence:CCGGCCAGCCAAGAAAGCTATCTCTCTCGAGAGAGATAGCTTTCTTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-409s1c1
Sequence:CCGGGCAAGAGATCTGCCATCCTAACTCGAGTTAGGATGGCAGATCTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001623.3-281s1c1
Sequence:CCGGCCTGAAACGAATGCTGGAGAACTCGAGTTCTCCAGCATTCGTTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019467
AIF1 MISSION shRNA Bacterial Glycerol Stock
allograft inflammatory factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-464s1c1
Sequence:CCGGCAAGGTGAAGTACATGGAGTTCTCGAGAACTCCATGTACTTCACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-611s1c1
Sequence:CCGGGACGTTCAGCTACTCTGACTTCTCGAGAAGTCAGAGTAGCTGAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-402s1c1
Sequence:CCGGCAATTCCTCGATGATCCCAAACTCGAGTTTGGGATCATCGAGGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-563s1c1
Sequence:CCGGCCTAGAGCTGAAGAGATTAATCTCGAGATTAATCTCTTCAGCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-665s1c1
Sequence:CCGGCTTGAGAATGATTCTGATGTACTCGAGTACATCAGAATCATTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019467
AIF1 MISSION shRNA shRNA Plasmid DNA
allograft inflammatory factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-464s1c1
Sequence:CCGGCAAGGTGAAGTACATGGAGTTCTCGAGAACTCCATGTACTTCACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-611s1c1
Sequence:CCGGGACGTTCAGCTACTCTGACTTCTCGAGAAGTCAGAGTAGCTGAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-402s1c1
Sequence:CCGGCAATTCCTCGATGATCCCAAACTCGAGTTTGGGATCATCGAGGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-563s1c1
Sequence:CCGGCCTAGAGCTGAAGAGATTAATCTCGAGATTAATCTCTTCAGCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-665s1c1
Sequence:CCGGCTTGAGAATGATTCTGATGTACTCGAGTACATCAGAATCATTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019467
AIF1 MISSION shRNA Lentiviral Transduction Particles
allograft inflammatory factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-464s1c1
Sequence:CCGGCAAGGTGAAGTACATGGAGTTCTCGAGAACTCCATGTACTTCACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-611s1c1
Sequence:CCGGGACGTTCAGCTACTCTGACTTCTCGAGAAGTCAGAGTAGCTGAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-402s1c1
Sequence:CCGGCAATTCCTCGATGATCCCAAACTCGAGTTTGGGATCATCGAGGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-563s1c1
Sequence:CCGGCCTAGAGCTGAAGAGATTAATCTCGAGATTAATCTCTTCAGCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019467.2-665s1c1
Sequence:CCGGCTTGAGAATGATTCTGATGTACTCGAGTACATCAGAATCATTCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)