EMAIL THIS PAGE TO A FRIEND

AIF1L

allograft inflammatory factor 1-like

117 Gene Product Result for
Synonyms: C9orf58 IBA2
UniProtKB ID: Q9BQI0, B2RBC4, Q6ZR40, Q8NAX7, Q8WU47, Q9H9G0
Gene ID:
Mouse(108897) allograft inflammatory factor 1-like
Rat(362107) allograft inflammatory factor 1-like
sheep(101122182) allograft inflammatory factor 1-like
domestic guinea pig(100715322) allograft inflammatory factor 1-like
naked mole-rat(101723352) allograft inflammatory factor 1-like
Zebrafish(321033) allograft inflammatory factor 1-like
domestic cat(101098753) allograft inflammatory factor 1-like
cow(617493) allograft inflammatory factor 1-like
dog(608545) allograft inflammatory factor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002260 Rosetta Predictions human pricing
NM_031426 Rosetta Predictions human pricing
NM_001108578 Rosetta Predictions rat pricing
NM_145144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034664 predicted 919
2 SASI_Hs01_00034665 predicted 931
3 SASI_Hs01_00034666 predicted 726
4 SASI_Hs01_00034667 predicted 333
5 SASI_Hs01_00034668 predicted 479
6 SASI_Hs01_00034669 predicted 481
7 SASI_Hs01_00034670 predicted 910
8 SASI_Hs01_00034671 predicted 326
9 SASI_Hs01_00034672 predicted 730
10 SASI_Hs01_00034673 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358820 predicted 243
2 SASI_Hs02_00358821 predicted 305
3 SASI_Hs02_00358822 predicted 998
4 SASI_Hs01_00047732 predicted 901
5 SASI_Hs01_00047730 predicted 879
6 SASI_Hs01_00047737 predicted 297
7 SASI_Hs02_00358823 predicted 269
8 SASI_Hs02_00358824 predicted 300
9 SASI_Hs02_00358825 predicted 294
10 SASI_Hs02_00358826 predicted 391
11 SASI_Hs01_00047731 predicted 961
12 SASI_Hs01_00047733 predicted 915
13 SASI_Hs01_00047734 predicted 703
14 SASI_Hs01_00047735 predicted 457
15 SASI_Hs01_00047736 predicted 461
16 SASI_Hs01_00047738 predicted 698
17 SASI_Hs01_00047739 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240019 predicted 272
2 SASI_Rn02_00240020 predicted 309
3 SASI_Rn02_00240021 predicted 323
4 SASI_Rn02_00240022 predicted 318
5 SASI_Rn02_00240023 predicted 881
6 SASI_Rn02_00240024 predicted 220
7 SASI_Rn02_00240025 predicted 642
8 SASI_Rn02_00240026 predicted 516
9 SASI_Rn02_00240027 predicted 643
10 SASI_Rn02_00240028 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119267 predicted 213
2 SASI_Mm01_00119268 predicted 237
3 SASI_Mm01_00119269 predicted 626
4 SASI_Mm01_00119270 predicted 354
5 SASI_Mm01_00119271 predicted 930
6 SASI_Mm01_00119272 predicted 833
7 SASI_Mm01_00119273 predicted 911
8 SASI_Mm01_00119274 predicted 558
9 SASI_Mm01_00119275 predicted 944
10 SASI_Mm01_00119276 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031426
VALIDATED
AIF1L MISSION shRNA Bacterial Glycerol Stock
allograft inflammatory factor 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031426.1-685s1c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-445s1c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-340s1c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-403s1c1
Sequence:CCGGCCGAGACTTTGTGAACATGATCTCGAGATCATGTTCACAAAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-282s1c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-462s21c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031426.2-702s21c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-357s21c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-299s21c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031426
VALIDATED
AIF1L MISSION shRNA shRNA Plasmid DNA
allograft inflammatory factor 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031426.1-685s1c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-445s1c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-340s1c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-403s1c1
Sequence:CCGGCCGAGACTTTGTGAACATGATCTCGAGATCATGTTCACAAAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-282s1c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-462s21c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031426.2-702s21c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-357s21c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-299s21c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031426
VALIDATED
AIF1L MISSION shRNA Lentiviral Transduction Particles
allograft inflammatory factor 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031426.1-685s1c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-445s1c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-340s1c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031426.1-403s1c1
Sequence:CCGGCCGAGACTTTGTGAACATGATCTCGAGATCATGTTCACAAAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031426.1-282s1c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-462s21c1
Sequence:CCGGCCTCAAGTTAGTCATGATGTTCTCGAGAACATCATGACTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031426.2-702s21c1
Sequence:CCGGGCACAAATTATCTGCCTTAAACTCGAGTTTAAGGCAGATAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-357s21c1
Sequence:CCGGCCACCTGGAGATGAAGAAGATCTCGAGATCTTCTTCATCTCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031426.2-299s21c1
Sequence:CCGGGCGAGATTGACCTGATGTCTTCTCGAGAAGACATCAGGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145144
VALIDATED
AIF1L MISSION shRNA Bacterial Glycerol Stock
allograft inflammatory factor 1-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145144.1-242s1c1
Sequence:CCGGGCGAGATTGATCTGATGTCTTCTCGAGAAGACATCAGATCAATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-1923s1c1
Sequence:CCGGGCAGTGAAATGGACTGATGTACTCGAGTACATCAGTCCATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-228s1c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-359s1c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-204s1c1
Sequence:CCGGCAAAGAGAAATACATGGAGTTCTCGAGAACTCCATGTATTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-363s1c1
Sequence:CCGGCCGAGACTTTGTGAATATGATCTCGAGATCATATTCACAAAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145144.1-407s21c1
Sequence:CCGGTCAAGCTGGTCATGATGTTTGCTCGAGCAAACATCATGACCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-86s21c1
Sequence:CCGGAGGCGTTCGGTTTGCTCAAAGCTCGAGCTTTGAGCAAACCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145144.1-577s21c1
Sequence:CCGGTGTTAGGTCTCCTGGGTTATGCTCGAGCATAACCCAGGAGACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-228s21c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-359s21c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145144
VALIDATED
AIF1L MISSION shRNA shRNA Plasmid DNA
allograft inflammatory factor 1-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145144.1-242s1c1
Sequence:CCGGGCGAGATTGATCTGATGTCTTCTCGAGAAGACATCAGATCAATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-1923s1c1
Sequence:CCGGGCAGTGAAATGGACTGATGTACTCGAGTACATCAGTCCATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-228s1c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-359s1c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-204s1c1
Sequence:CCGGCAAAGAGAAATACATGGAGTTCTCGAGAACTCCATGTATTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-363s1c1
Sequence:CCGGCCGAGACTTTGTGAATATGATCTCGAGATCATATTCACAAAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145144.1-407s21c1
Sequence:CCGGTCAAGCTGGTCATGATGTTTGCTCGAGCAAACATCATGACCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-86s21c1
Sequence:CCGGAGGCGTTCGGTTTGCTCAAAGCTCGAGCTTTGAGCAAACCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145144.1-577s21c1
Sequence:CCGGTGTTAGGTCTCCTGGGTTATGCTCGAGCATAACCCAGGAGACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-228s21c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-359s21c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145144
VALIDATED
AIF1L MISSION shRNA Lentiviral Transduction Particles
allograft inflammatory factor 1-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145144.1-242s1c1
Sequence:CCGGGCGAGATTGATCTGATGTCTTCTCGAGAAGACATCAGATCAATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-1923s1c1
Sequence:CCGGGCAGTGAAATGGACTGATGTACTCGAGTACATCAGTCCATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-228s1c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145144.1-359s1c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-204s1c1
Sequence:CCGGCAAAGAGAAATACATGGAGTTCTCGAGAACTCCATGTATTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145144.1-363s1c1
Sequence:CCGGCCGAGACTTTGTGAATATGATCTCGAGATCATATTCACAAAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145144.1-407s21c1
Sequence:CCGGTCAAGCTGGTCATGATGTTTGCTCGAGCAAACATCATGACCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-86s21c1
Sequence:CCGGAGGCGTTCGGTTTGCTCAAAGCTCGAGCTTTGAGCAAACCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145144.1-577s21c1
Sequence:CCGGTGTTAGGTCTCCTGGGTTATGCTCGAGCATAACCCAGGAGACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-228s21c1
Sequence:CCGGCCTGAATAATGAAGGCGAGATCTCGAGATCTCGCCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145144.1-359s21c1
Sequence:CCGGCCTACCGAGACTTTGTGAATACTCGAGTATTCACAAAGTCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks