EMAIL THIS PAGE TO A FRIEND

AIFM1

apoptosis-inducing factor, mitochondrion-associated, 1

90 Gene Product Result for
Synonyms: AIF CMTX4 COWCK COXPD6 PDCD8
Gene ID:
Human(9131) Summary: This gene encodes a flavoprotein essential for nuclear disassembly in apoptotic cells, and it is found in the mitochondrial intermembrane space in healthy cells. Induction of apoptosis results in the translocation of this protein to the nucleus where it affects chromosome condensation and fragmentation. In addition, this gene product induces mitochondria to release the apoptogenic proteins cytochrome c and caspase-9. Mutations in this gene cause combined oxidative phosphorylation deficiency 6, which results in a severe mitochondrial encephalomyopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 10. [provided by RefSeq, May 2010]
Mouse(26926) apoptosis-inducing factor, mitochondrion-associated 1
Rat(83533) apoptosis-inducing factor, mitochondrion-associated 1
Zebrafish(373125) apoptosis-inducing factor, mitochondrion-associated 1
cow(535714) apoptosis-inducing factor, mitochondrion-associated, 1
Horse(100054546) apoptosis-inducing factor, mitochondrion-associated, 1
domestic cat(768258) apoptosis-inducing factor, mitochondrion-associated, 1
dog(481048) apoptosis-inducing factor, mitochondrion-associated, 1
chicken(428688) apoptosis-inducing factor, mitochondrion-associated, 1
naked mole-rat(101698690) apoptosis-inducing factor, mitochondrion-associated, 1
domestic guinea pig(100730787) apoptosis-inducing factor, mitochondrion-associated, 1
sheep(101121574) apoptosis-inducing factor, mitochondrion-associated, 1
sheep(100188912) apoptosis-inducing factor, mitochondrion-associated, 1
Domestic Rabbit(100347778) apoptosis-inducing factor, mitochondrion-associated, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500441 Anti-AIF antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1406783 Anti-AIFM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108084 Anti-AIFM1 antibody produced in rabbit affinity isolated antibody horse, rabbit, canine
western blot pricing
SAB2100079 Anti-AIFM1 antibody produced in rabbit affinity isolated antibody, lyophilized powder chicken, canine, bovine, human, rat, mouse, rabbit, zebrafish, horse
western blot pricing
HPA030611 Anti-AIFM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
A7549 Anti-Apoptosis-Inducing Factor antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
microarray, western blot pricing
AV40199 Anti-PDCD8 (AB1) antibody produced in rabbit affinity isolated antibody rabbit, bovine, guinea pig, zebrafish, mouse, rat, canine, horse, sheep, human
western blot pricing
AV00028 Anti-PDCD8 (AB2) antibody produced in rabbit affinity isolated antibody bovine, sheep, canine, human
immunohistochemistry, western blot pricing
SAB5300151 Monoclonal Anti-AIFM1 antibody produced in mouse clone 4E7, ascites fluid rat, human, mouse, monkey
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004208 Rosetta Predictions human pricing
NM_145812 Rosetta Predictions human pricing
NM_145813 Rosetta Predictions human pricing
NM_031356 Rosetta Predictions rat pricing
NM_012019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099631 predicted 1642
2 SASI_Hs01_00099633 predicted 1651
3 SASI_Hs01_00099634 predicted 1487
4 SASI_Hs02_00337112 predicted 1756
5 SASI_Hs01_00099635 predicted 1600
6 SASI_Hs02_00337113 predicted 1775
7 SASI_Hs01_00099636 predicted 1984
8 SASI_Hs01_00099637 predicted 1745
9 SASI_Hs01_00099638 predicted 1591
10 SASI_Hs01_00099639 predicted 1393
11 SASI_Hs01_00099632 predicted 1559
12 SASI_Hs01_00099640 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015937 predicted 1627
2 SASI_Hs01_00015939 predicted 1643
3 SASI_Hs01_00015940 predicted 1480
4 SASI_Hs02_00365372 predicted 1740
5 SASI_Hs01_00015941 predicted 1587
6 SASI_Hs02_00365373 predicted 1761
7 SASI_Hs01_00015942 predicted 1968
8 SASI_Hs01_00015943 predicted 1731
9 SASI_Hs01_00015944 predicted 1577
10 SASI_Hs01_00015945 predicted 1389
11 SASI_Hs01_00015938 predicted 1544
12 SASI_Hs01_00015946 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080977 predicted 779
2 SASI_Hs01_00080979 predicted 788
3 SASI_Hs01_00080980 predicted 631
4 SASI_Hs02_00365374 predicted 895
5 SASI_Hs01_00080981 predicted 739
6 SASI_Hs02_00365375 predicted 910
7 SASI_Hs01_00080982 predicted 1121
8 SASI_Hs01_00080983 predicted 883
9 SASI_Hs01_00080984 predicted 725
10 SASI_Hs01_00080985 predicted 536
11 SASI_Hs01_00080978 predicted 696
12 SASI_Hs01_00080986 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089177 predicted 1201
2 SASI_Rn02_00264612 predicted 1843
3 SASI_Rn01_00089178 predicted 1826
4 SASI_Rn01_00089179 predicted 320
5 SASI_Rn01_00089180 predicted 1389
6 SASI_Rn01_00089181 predicted 308
7 SASI_Rn02_00264613 predicted 1299
8 SASI_Rn01_00089183 predicted 679
9 SASI_Rn01_00089185 predicted 363
10 SASI_Rn02_00264614 predicted 1413
11 SASI_Rn01_00089182 predicted 1816
12 SASI_Rn01_00089184 predicted 277
13 SASI_Rn01_00089186 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086071 predicted 1062
2 SASI_Mm01_00086072 predicted 1533
3 SASI_Mm01_00086073 predicted 1406
4 SASI_Mm01_00086074 predicted 772
5 SASI_Mm01_00086075 predicted 368
6 SASI_Mm01_00086076 predicted 1285
7 SASI_Mm01_00086077 predicted 289
8 SASI_Mm01_00086078 predicted 651
9 SASI_Mm01_00086079 predicted 1303
10 SASI_Mm01_00086080 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012019
VALIDATED
AIFM1 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012019.2-1936s21c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1114s21c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1210s21c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1904s21c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1825s21c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012019.2-1936s1c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1114s1c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1210s1c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012019.2-1904s1c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1825s1c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012019
VALIDATED
AIFM1 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012019.2-1936s21c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1114s21c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1210s21c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1904s21c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1825s21c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012019.2-1936s1c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1114s1c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1210s1c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012019.2-1904s1c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1825s1c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012019
VALIDATED
AIFM1 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012019.2-1936s21c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1114s21c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1210s21c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1904s21c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012019.2-1825s21c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012019.2-1936s1c1
Sequence:CCGGCGTGGAATACACAAGCACTTTCTCGAGAAAGTGCTTGTGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1114s1c1
Sequence:CCGGCCTTCCTCAATACCTCAGCAACTCGAGTTGCTGAGGTATTGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1210s1c1
Sequence:CCGGCGGTGGCAGGTTACTCATTAACTCGAGTTAATGAGTAACCTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012019.2-1904s1c1
Sequence:CCGGCTCTTCAACATTCATGAAGATCTCGAGATCTTCATGAATGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012019.2-1825s1c1
Sequence:CCGGCGTCTTTAACCGAATGCCAATCTCGAGATTGGCATTCGGTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004208
VALIDATED
AIFM1 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1062s21c1
Sequence:GTACCGGAGATTTCACGGGAAGTCAAATCTCGAGATTTGACTTCCCGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-569s21c1
Sequence:GTACCGGCATGTTCCTTTCCTGCTAATTCTCGAGAATTAGCAGGAAAGGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-2024s21c1
Sequence:CCGGCCCACAGTGGAATTGGCAAACCTCGAGGTTTGCCAATTCCACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1494s21c1
Sequence:CCGGCTGCATGCTTCTACGATATAACTCGAGTTATATCGTAGAAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1430s21c1
Sequence:CCGGTTTGGTGGCTTCCGGGTAAATCTCGAGATTTACCCGGAAGCCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004208.2-921s1c1
Sequence:CCGGGCTCTCAAATAACCTATGAAACTCGAGTTTCATAGGTTATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1411s1c1
Sequence:CCGGCCTGGAAATAGACTCAGATTTCTCGAGAAATCTGAGTCTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1991s1c1
Sequence:CCGGGCCAAACTATTCAACATTCATCTCGAGATGAATGTTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1182s1c1
Sequence:CCGGCCGAGAAAGGAAATATGGGAACTCGAGTTCCCATATTTCCTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-749s1c1
Sequence:CCGGCTGCGATTCAAACAGTGGAATCTCGAGATTCCACTGTTTGAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004208
VALIDATED
AIFM1 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1062s21c1
Sequence:GTACCGGAGATTTCACGGGAAGTCAAATCTCGAGATTTGACTTCCCGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-569s21c1
Sequence:GTACCGGCATGTTCCTTTCCTGCTAATTCTCGAGAATTAGCAGGAAAGGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-2024s21c1
Sequence:CCGGCCCACAGTGGAATTGGCAAACCTCGAGGTTTGCCAATTCCACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1494s21c1
Sequence:CCGGCTGCATGCTTCTACGATATAACTCGAGTTATATCGTAGAAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1430s21c1
Sequence:CCGGTTTGGTGGCTTCCGGGTAAATCTCGAGATTTACCCGGAAGCCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004208.2-921s1c1
Sequence:CCGGGCTCTCAAATAACCTATGAAACTCGAGTTTCATAGGTTATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1411s1c1
Sequence:CCGGCCTGGAAATAGACTCAGATTTCTCGAGAAATCTGAGTCTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1991s1c1
Sequence:CCGGGCCAAACTATTCAACATTCATCTCGAGATGAATGTTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1182s1c1
Sequence:CCGGCCGAGAAAGGAAATATGGGAACTCGAGTTCCCATATTTCCTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-749s1c1
Sequence:CCGGCTGCGATTCAAACAGTGGAATCTCGAGATTCCACTGTTTGAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004208
VALIDATED
AIFM1 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1062s21c1
Sequence:GTACCGGAGATTTCACGGGAAGTCAAATCTCGAGATTTGACTTCCCGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-569s21c1
Sequence:GTACCGGCATGTTCCTTTCCTGCTAATTCTCGAGAATTAGCAGGAAAGGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-2024s21c1
Sequence:CCGGCCCACAGTGGAATTGGCAAACCTCGAGGTTTGCCAATTCCACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1494s21c1
Sequence:CCGGCTGCATGCTTCTACGATATAACTCGAGTTATATCGTAGAAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004208.2-1430s21c1
Sequence:CCGGTTTGGTGGCTTCCGGGTAAATCTCGAGATTTACCCGGAAGCCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004208.2-921s1c1
Sequence:CCGGGCTCTCAAATAACCTATGAAACTCGAGTTTCATAGGTTATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1411s1c1
Sequence:CCGGCCTGGAAATAGACTCAGATTTCTCGAGAAATCTGAGTCTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1991s1c1
Sequence:CCGGGCCAAACTATTCAACATTCATCTCGAGATGAATGTTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-1182s1c1
Sequence:CCGGCCGAGAAAGGAAATATGGGAACTCGAGTTCCCATATTTCCTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004208.2-749s1c1
Sequence:CCGGCTGCGATTCAAACAGTGGAATCTCGAGATTCCACTGTTTGAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks