EMAIL THIS PAGE TO A FRIEND

AIFM2

apoptosis-inducing factor, mitochondrion-associated, 2

94 Gene Product Result for
Synonyms: AMID PRG3 RP11-367H5.2
UniProtKB ID: Q9BRQ8, B3KXI0, Q63Z39
Gene ID:
Human(84883) Summary: This gene encodes a flavoprotein oxidoreductase that binds single stranded DNA and is thought to contribute to apoptosis in the presence of bacterial and viral DNA. The expression of this gene is also found to be induced by tumor suppressor protein p53 in colon cancer cells. [provided by RefSeq, Nov 2010]
Mouse(71361) apoptosis-inducing factor, mitochondrion-associated 2
Rat(361843) apoptosis-inducing factor, mitochondrion-associated 2
Zebrafish(552995) apoptosis-inducing factor, mitochondrion-associated, 2
chicken(423720) apoptosis-inducing factor, mitochondrion-associated, 2
domestic cat(101095771) apoptosis-inducing factor, mitochondrion-associated, 2
cow(534217) apoptosis-inducing factor, mitochondrion-associated, 2
dog(479236) apoptosis-inducing factor, mitochondrion-associated, 2
sheep(101108883) apoptosis-inducing factor, mitochondrion-associated, 2
Domestic Rabbit(100343674) apoptosis-inducing factor, mitochondrion-associated, 2
domestic guinea pig(100712848) apoptosis-inducing factor, mitochondrion-associated, 2
naked mole-rat(101711394) apoptosis-inducing factor, mitochondrion-associated, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032797 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032797 Rosetta Predictions human pricing
NM_001108534 Rosetta Predictions rat pricing
NM_001039194 Rosetta Predictions mouse pricing
NM_153779 Rosetta Predictions mouse pricing
NM_178058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117489 predicted 856
2 SASI_Hs01_00117490 predicted 1657
3 SASI_Hs02_00360357 predicted 706
4 SASI_Hs02_00360358 predicted 1408
5 SASI_Hs01_00117492 predicted 1224
6 SASI_Hs01_00117494 predicted 1240
7 SASI_Hs01_00117495 predicted 864
8 SASI_Hs02_00360359 predicted 1209
9 SASI_Hs01_00117496 predicted 926
10 SASI_Hs01_00117497 predicted 1526
11 SASI_Hs01_00117488 predicted 1420
12 SASI_Hs01_00117491 predicted 1441
13 SASI_Hs01_00117493 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239589 predicted 1014
2 SASI_Rn02_00239590 predicted 239
3 SASI_Rn02_00239591 predicted 788
4 SASI_Rn02_00239592 predicted 639
5 SASI_Rn02_00239593 predicted 457
6 SASI_Rn02_00239594 predicted 382
7 SASI_Rn02_00239595 predicted 710
8 SASI_Rn02_00239596 predicted 804
9 SASI_Rn02_00239597 predicted 407
10 SASI_Rn02_00239598 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289936 predicted 806
2 SASI_Mm01_00197140 predicted 723
3 SASI_Mm01_00197141 predicted 587
4 SASI_Mm01_00197142 predicted 547
5 SASI_Mm01_00197143 predicted 793
6 SASI_Mm01_00197144 predicted 741
7 SASI_Mm01_00197145 predicted 473
8 SASI_Mm01_00197146 predicted 825
9 SASI_Mm01_00197147 predicted 432
10 SASI_Mm01_00197148 predicted 595
11 SASI_Mm01_00197149 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343500 predicted 821
2 SASI_Mm01_00054636 predicted 744
3 SASI_Mm01_00054637 predicted 604
4 SASI_Mm01_00054638 predicted 565
5 SASI_Mm01_00054639 predicted 817
6 SASI_Mm01_00054640 predicted 765
7 SASI_Mm01_00054641 predicted 494
8 SASI_Mm01_00054642 predicted 848
9 SASI_Mm01_00054643 predicted 448
10 SASI_Mm01_00054644 predicted 613
11 SASI_Mm01_00054645 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348519 predicted 787
2 SASI_Mm01_00161940 predicted 700
3 SASI_Mm01_00161941 predicted 565
4 SASI_Mm01_00161942 predicted 523
5 SASI_Mm01_00161943 predicted 777
6 SASI_Mm01_00161944 predicted 717
7 SASI_Mm01_00161945 predicted 450
8 SASI_Mm01_00161946 predicted 811
9 SASI_Mm01_00161947 predicted 400
10 SASI_Mm01_00161948 predicted 566
11 SASI_Mm01_00161949 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153779
VALIDATED
AIFM2 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-1180s1c1
Sequence:CCGGGCCATGTGAGAACTCTACAGACTCGAGTCTGTAGAGTTCTCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-356s1c1
Sequence:CCGGCATAGACTTGAAGAACCGGATCTCGAGATCCGGTTCTTCAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153779.1-755s1c1
Sequence:CCGGCAATGAGTATCGGGAGTACATCTCGAGATGTACTCCCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-885s1c1
Sequence:CCGGGCTAGCAATGGTGCTCTGAAACTCGAGTTTCAGAGCACCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-339s1c1
Sequence:CCGGCAGGGCAAAGTGATTGGCATACTCGAGTATGCCAATCACTTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153779
VALIDATED
AIFM2 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-1180s1c1
Sequence:CCGGGCCATGTGAGAACTCTACAGACTCGAGTCTGTAGAGTTCTCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-356s1c1
Sequence:CCGGCATAGACTTGAAGAACCGGATCTCGAGATCCGGTTCTTCAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153779.1-755s1c1
Sequence:CCGGCAATGAGTATCGGGAGTACATCTCGAGATGTACTCCCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-885s1c1
Sequence:CCGGGCTAGCAATGGTGCTCTGAAACTCGAGTTTCAGAGCACCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-339s1c1
Sequence:CCGGCAGGGCAAAGTGATTGGCATACTCGAGTATGCCAATCACTTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153779
VALIDATED
AIFM2 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-1180s1c1
Sequence:CCGGGCCATGTGAGAACTCTACAGACTCGAGTCTGTAGAGTTCTCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-356s1c1
Sequence:CCGGCATAGACTTGAAGAACCGGATCTCGAGATCCGGTTCTTCAAGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153779.1-755s1c1
Sequence:CCGGCAATGAGTATCGGGAGTACATCTCGAGATGTACTCCCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-885s1c1
Sequence:CCGGGCTAGCAATGGTGCTCTGAAACTCGAGTTTCAGAGCACCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153779.1-339s1c1
Sequence:CCGGCAGGGCAAAGTGATTGGCATACTCGAGTATGCCAATCACTTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032797
AIFM2 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-561s1c1
Sequence:CCGGCGGGCAAGTTTAATGAGGTTTCTCGAGAAACCTCATTAAACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-412s1c1
Sequence:CCGGCATTTCTTACTCGGTGACTTTCTCGAGAAAGTCACCGAGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-511s1c1
Sequence:CCGGCCTGCCCTTCTCTCATCTTATCTCGAGATAAGATGAGAGAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-865s1c1
Sequence:CCGGCAATGAGTATCGAGAGTACATCTCGAGATGTACTCTCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-1135s1c1
Sequence:CCGGCAACATCGTCAACTCTGTGAACTCGAGTTCACAGAGTTGACGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1667s21c1
Sequence:CCGGGTACGTGCTTGTGGTCATGACCTCGAGGTCATGACCACAAGCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032797.4-931s21c1
Sequence:CCGGGATTCTCTGCACCGGCATCAACTCGAGTTGATGCCGGTGCAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1451s21c1
Sequence:CCGGATGATGTGGTGGCTAGAAATGCTCGAGCATTTCTAGCCACCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032797
AIFM2 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-561s1c1
Sequence:CCGGCGGGCAAGTTTAATGAGGTTTCTCGAGAAACCTCATTAAACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-412s1c1
Sequence:CCGGCATTTCTTACTCGGTGACTTTCTCGAGAAAGTCACCGAGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-511s1c1
Sequence:CCGGCCTGCCCTTCTCTCATCTTATCTCGAGATAAGATGAGAGAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-865s1c1
Sequence:CCGGCAATGAGTATCGAGAGTACATCTCGAGATGTACTCTCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-1135s1c1
Sequence:CCGGCAACATCGTCAACTCTGTGAACTCGAGTTCACAGAGTTGACGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1667s21c1
Sequence:CCGGGTACGTGCTTGTGGTCATGACCTCGAGGTCATGACCACAAGCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032797.4-931s21c1
Sequence:CCGGGATTCTCTGCACCGGCATCAACTCGAGTTGATGCCGGTGCAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1451s21c1
Sequence:CCGGATGATGTGGTGGCTAGAAATGCTCGAGCATTTCTAGCCACCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032797
AIFM2 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-561s1c1
Sequence:CCGGCGGGCAAGTTTAATGAGGTTTCTCGAGAAACCTCATTAAACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-412s1c1
Sequence:CCGGCATTTCTTACTCGGTGACTTTCTCGAGAAAGTCACCGAGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-511s1c1
Sequence:CCGGCCTGCCCTTCTCTCATCTTATCTCGAGATAAGATGAGAGAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-865s1c1
Sequence:CCGGCAATGAGTATCGAGAGTACATCTCGAGATGTACTCTCGATACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032797.4-1135s1c1
Sequence:CCGGCAACATCGTCAACTCTGTGAACTCGAGTTCACAGAGTTGACGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1667s21c1
Sequence:CCGGGTACGTGCTTGTGGTCATGACCTCGAGGTCATGACCACAAGCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032797.4-931s21c1
Sequence:CCGGGATTCTCTGCACCGGCATCAACTCGAGTTGATGCCGGTGCAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032797.4-1451s21c1
Sequence:CCGGATGATGTGGTGGCTAGAAATGCTCGAGCATTTCTAGCCACCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks