EMAIL THIS PAGE TO A FRIEND

AIFM3

apoptosis-inducing factor, mitochondrion-associated, 3

111 Gene Product Result for
Synonyms: AIFL
Gene ID:
Mouse(72168) apoptosis-inducing factor, mitochondrion-associated 3
Rat(303786) apoptosis-inducing factor, mitochondrion-associated 3
naked mole-rat(101704133) apoptosis-inducing factor, mitochondrion-associated, 3
domestic guinea pig(100724244) apoptosis-inducing factor, mitochondrion-associated, 3
sheep(101118054) apoptosis-inducing factor, mitochondrion-associated, 3
Domestic Rabbit(100345791) apoptosis-inducing factor, mitochondrion-associated, 3
chicken(416999) apoptosis-inducing factor, mitochondrion-associated, 3
cow(526295) apoptosis-inducing factor, mitochondrion-associated, 3
Horse(100056937) apoptosis-inducing factor, mitochondrion-associated, 3
domestic cat(101084492) apoptosis-inducing factor, mitochondrion-associated, 3
dog(486440) apoptosis-inducing factor, mitochondrion-associated, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001271 Anti-AIFM3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100081 Anti-AIFM3 antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, rabbit, human, guinea pig
western blot pricing
SAB3500203 Anti-AIFM3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB3500983 Anti-AIFM3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018060 Rosetta Predictions human pricing
NM_144704 Rosetta Predictions human pricing
XM_001058959 Rosetta Predictions rat pricing
XM_001066198 Rosetta Predictions rat pricing
XM_001066255 Rosetta Predictions rat pricing
XM_001066308 Rosetta Predictions rat pricing
XM_221261 Rosetta Predictions rat pricing
NM_175178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109948 predicted 206
2 SASI_Hs01_00109949 predicted 1003
3 SASI_Hs01_00109950 predicted 1146
4 SASI_Hs01_00109951 predicted 492
5 SASI_Hs01_00109952 predicted 959
6 SASI_Hs02_00306952 predicted 750
7 SASI_Hs01_00109954 predicted 1567
8 SASI_Hs01_00109955 predicted 198
9 SASI_Hs01_00109956 predicted 728
10 SASI_Hs01_00109957 predicted 669
11 SASI_Hs01_00109953 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117328 predicted 229
2 SASI_Hs01_00117329 predicted 1019
3 SASI_Hs01_00117330 predicted 1161
4 SASI_Hs01_00117331 predicted 516
5 SASI_Hs01_00117332 predicted 975
6 SASI_Hs02_00364643 predicted 769
7 SASI_Hs01_00117334 predicted 1583
8 SASI_Hs01_00117335 predicted 222
9 SASI_Hs01_00117336 predicted 746
10 SASI_Hs01_00117337 predicted 679
11 SASI_Hs01_00117333 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291413 predicted 1185
2 SASI_Rn02_00291414 predicted 267
3 SASI_Rn02_00291415 predicted 503
4 SASI_Rn02_00291416 predicted 742
5 SASI_Rn02_00291417 predicted 788
6 SASI_Rn02_00291418 predicted 611
7 SASI_Rn02_00291419 predicted 314
8 SASI_Rn02_00291420 predicted 336
9 SASI_Rn02_00291421 predicted 611
10 SASI_Rn02_00291422 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316623 predicted 1575
2 SASI_Rn02_00316624 predicted 1544
3 SASI_Rn02_00316625 predicted 1441
4 SASI_Rn02_00316626 predicted 1794
5 SASI_Rn02_00316627 predicted 757
6 SASI_Rn02_00316628 predicted 1915
7 SASI_Rn02_00316629 predicted 1501
8 SASI_Rn02_00316630 predicted 1039
9 SASI_Rn02_00316631 predicted 1503
10 SASI_Rn02_00316632 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316844 predicted 1623
2 SASI_Rn02_00316845 predicted 1795
3 SASI_Rn02_00316846 predicted 1857
4 SASI_Rn02_00316847 predicted 2235
5 SASI_Rn02_00316848 predicted 1042
6 SASI_Rn02_00316849 predicted 2315
7 SASI_Rn02_00316850 predicted 1387
8 SASI_Rn02_00316851 predicted 1487
9 SASI_Rn02_00316852 predicted 866
10 SASI_Rn02_00316853 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317016 predicted 1619
2 SASI_Rn02_00317017 predicted 1790
3 SASI_Rn02_00317018 predicted 1861
4 SASI_Rn02_00317019 predicted 2237
5 SASI_Rn02_00317020 predicted 1045
6 SASI_Rn02_00317021 predicted 1379
7 SASI_Rn02_00317022 predicted 1488
8 SASI_Rn02_00317023 predicted 872
9 SASI_Rn02_00317024 predicted 1176
10 SASI_Rn02_00317025 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136392 predicted 203
2 SASI_Rn01_00136393 predicted 202
3 SASI_Rn01_00136394 predicted 210
4 SASI_Rn01_00136395 predicted 231
5 SASI_Rn01_00136396 predicted 229
6 SASI_Rn01_00136397 predicted 265
7 SASI_Rn01_00136398 predicted 256
8 SASI_Rn01_00136399 predicted 208
9 SASI_Rn01_00136400 predicted 225
10 SASI_Rn01_00136401 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104921 predicted 1364
2 SASI_Mm01_00104922 predicted 2028
3 SASI_Mm01_00104923 predicted 1580
4 SASI_Mm01_00104924 predicted 1454
5 SASI_Mm01_00104925 predicted 1701
6 SASI_Mm01_00104926 predicted 2126
7 SASI_Mm01_00104927 predicted 994
8 SASI_Mm01_00104928 predicted 2050
9 SASI_Mm01_00104929 predicted 1574
10 SASI_Mm01_00104930 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144704
AIFM3 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1865s21c1
Sequence:CCGGCACTAAAGGCGACGAGGTGATCTCGAGATCACCTCGTCGCCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1120s21c1
Sequence:CCGGCCAAGACTCTGAGCTGCAAAGCTCGAGCTTTGCAGCTCAGAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1587s21c1
Sequence:CCGGACCAATGTCCCAGGCGTGTTTCTCGAGAAACACGCCTGGGACATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-787s21c1
Sequence:CCGGGGTACAGCAGTAGCACCAATGCTCGAGCATTGGTGCTACTGCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1149s21c1
Sequence:CCGGGTGGAGAACGTGTTCACTATCCTCGAGGATAGTGAACACGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1027s1c1
Sequence:CCGGGAGAACTAAGAAGGTCGTGTTCTCGAGAACACGACCTTCTTAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-746s1c1
Sequence:CCGGGCCAAGTGTATCTCTCCAAGTCTCGAGACTTGGAGAGATACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1351s1c1
Sequence:CCGGGTTTGAGAACAACCGGGTGAACTCGAGTTCACCCGGTTGTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1880s1c1
Sequence:CCGGAGCATGAACTACGATCCCATTCTCGAGAATGGGATCGTAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1637s1c1
Sequence:CCGGCGCAAAGTGAACATTCCACATCTCGAGATGTGGAATGTTCACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144704
AIFM3 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1865s21c1
Sequence:CCGGCACTAAAGGCGACGAGGTGATCTCGAGATCACCTCGTCGCCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1120s21c1
Sequence:CCGGCCAAGACTCTGAGCTGCAAAGCTCGAGCTTTGCAGCTCAGAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1587s21c1
Sequence:CCGGACCAATGTCCCAGGCGTGTTTCTCGAGAAACACGCCTGGGACATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-787s21c1
Sequence:CCGGGGTACAGCAGTAGCACCAATGCTCGAGCATTGGTGCTACTGCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1149s21c1
Sequence:CCGGGTGGAGAACGTGTTCACTATCCTCGAGGATAGTGAACACGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1027s1c1
Sequence:CCGGGAGAACTAAGAAGGTCGTGTTCTCGAGAACACGACCTTCTTAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-746s1c1
Sequence:CCGGGCCAAGTGTATCTCTCCAAGTCTCGAGACTTGGAGAGATACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1351s1c1
Sequence:CCGGGTTTGAGAACAACCGGGTGAACTCGAGTTCACCCGGTTGTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1880s1c1
Sequence:CCGGAGCATGAACTACGATCCCATTCTCGAGAATGGGATCGTAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1637s1c1
Sequence:CCGGCGCAAAGTGAACATTCCACATCTCGAGATGTGGAATGTTCACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144704
AIFM3 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1865s21c1
Sequence:CCGGCACTAAAGGCGACGAGGTGATCTCGAGATCACCTCGTCGCCTTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1120s21c1
Sequence:CCGGCCAAGACTCTGAGCTGCAAAGCTCGAGCTTTGCAGCTCAGAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1587s21c1
Sequence:CCGGACCAATGTCCCAGGCGTGTTTCTCGAGAAACACGCCTGGGACATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-787s21c1
Sequence:CCGGGGTACAGCAGTAGCACCAATGCTCGAGCATTGGTGCTACTGCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144704.2-1149s21c1
Sequence:CCGGGTGGAGAACGTGTTCACTATCCTCGAGGATAGTGAACACGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1027s1c1
Sequence:CCGGGAGAACTAAGAAGGTCGTGTTCTCGAGAACACGACCTTCTTAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-746s1c1
Sequence:CCGGGCCAAGTGTATCTCTCCAAGTCTCGAGACTTGGAGAGATACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1351s1c1
Sequence:CCGGGTTTGAGAACAACCGGGTGAACTCGAGTTCACCCGGTTGTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1880s1c1
Sequence:CCGGAGCATGAACTACGATCCCATTCTCGAGAATGGGATCGTAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144704.1-1637s1c1
Sequence:CCGGCGCAAAGTGAACATTCCACATCTCGAGATGTGGAATGTTCACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175178
AIFM3 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing factor, mitochondrion-associated, 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1431s1c1
Sequence:CCGGGCTGCTTATCTGACTGAGAAACTCGAGTTTCTCAGTCAGATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175178.2-2410s1c1
Sequence:CCGGCCTATGTCTTACCTTCCCTTTCTCGAGAAAGGGAAGGTAAGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-843s1c1
Sequence:CCGGCATAAGTTCCAGGTGAAGATTCTCGAGAATCTTCACCTGGAACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1214s1c1
Sequence:CCGGGAGAAATAAGAAGGTTGTGTTCTCGAGAACACAACCTTCTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175178
AIFM3 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing factor, mitochondrion-associated, 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1431s1c1
Sequence:CCGGGCTGCTTATCTGACTGAGAAACTCGAGTTTCTCAGTCAGATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175178.2-2410s1c1
Sequence:CCGGCCTATGTCTTACCTTCCCTTTCTCGAGAAAGGGAAGGTAAGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-843s1c1
Sequence:CCGGCATAAGTTCCAGGTGAAGATTCTCGAGAATCTTCACCTGGAACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1214s1c1
Sequence:CCGGGAGAAATAAGAAGGTTGTGTTCTCGAGAACACAACCTTCTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175178
AIFM3 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing factor, mitochondrion-associated, 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1431s1c1
Sequence:CCGGGCTGCTTATCTGACTGAGAAACTCGAGTTTCTCAGTCAGATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175178.2-2410s1c1
Sequence:CCGGCCTATGTCTTACCTTCCCTTTCTCGAGAAAGGGAAGGTAAGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-843s1c1
Sequence:CCGGCATAAGTTCCAGGTGAAGATTCTCGAGAATCTTCACCTGGAACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175178.2-1214s1c1
Sequence:CCGGGAGAAATAAGAAGGTTGTGTTCTCGAGAACACAACCTTCTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks