EMAIL THIS PAGE TO A FRIEND

AIG1

androgen-induced 1

142 Gene Product Result for
Synonyms: AIG-1 dJ95L4.1
Gene ID:
Mouse(66253) androgen-induced 1
Rat(292486) androgen-induced 1
Zebrafish(562261) androgen-induced 1 (H. sapiens)
chicken(421671) androgen-induced 1
Thale Cress(840293) protein AIG1
cow(614409) androgen-induced 1
domestic cat(101090109) androgen-induced 1
dog(611677) androgen-induced 1
sheep(101117593) androgen-induced 1
domestic guinea pig(100733865) androgen-induced 1
naked mole-rat(101725516) androgen-induced 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016108 Rosetta Predictions human pricing
NM_001134425 Rosetta Predictions rat pricing
NM_025446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029278 predicted 345
2 SASI_Hs01_00029280 predicted 511
3 SASI_Hs01_00029281 predicted 770
4 SASI_Hs01_00029282 predicted 451
5 SASI_Hs01_00029283 predicted 671
6 SASI_Hs01_00029284 predicted 638
7 SASI_Hs01_00029285 predicted 415
8 SASI_Hs01_00029286 predicted 524
9 SASI_Hs01_00029287 predicted 354
10 SASI_Hs02_00348880 predicted 678
11 SASI_Hs01_00029279 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256309 predicted 1073
2 SASI_Rn02_00256310 predicted 810
3 SASI_Rn02_00256311 predicted 949
4 SASI_Rn02_00256312 predicted 369
5 SASI_Rn02_00256313 predicted 438
6 SASI_Rn02_00256314 predicted 349
7 SASI_Rn02_00256315 predicted 1035
8 SASI_Rn02_00256316 predicted 593
9 SASI_Rn02_00256317 predicted 899
10 SASI_Rn02_00256318 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077758 predicted 610
2 SASI_Mm01_00077759 predicted 424
3 SASI_Mm01_00077760 predicted 531
4 SASI_Mm01_00077761 predicted 689
5 SASI_Mm01_00077762 predicted 668
6 SASI_Mm01_00077763 predicted 699
7 SASI_Mm01_00077765 predicted 620
8 SASI_Mm01_00077766 predicted 246
9 SASI_Mm01_00077767 predicted 400
10 SASI_Mm02_00328277 predicted 387
11 SASI_Mm01_00077764 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025446
VALIDATED
AIG1 MISSION shRNA Bacterial Glycerol Stock
androgen-induced 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-724s1c1
Sequence:CCGGCTAAACAGCTATATCTGGGATCTCGAGATCCCAGATATAGCTGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-600s1c1
Sequence:CCGGGATACATCATGTCACCGGCATCTCGAGATGCCGGTGACATGATGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-106s1c1
Sequence:CCGGGTAGCAATCCTGCTATCCTATCTCGAGATAGGATAGCAGGATTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025446.1-896s1c1
Sequence:CCGGCTTTCAGAGAGATTTGGGCATCTCGAGATGCCCAAATCTCTCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-562s21c1
Sequence:CCGGACCTTCTCCGTGGGCTATATACTCGAGTATATAGCCCACGGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-402s21c1
Sequence:CCGGCTATGACAGAGAGATGATATACTCGAGTATATCATCTCTCTGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-138s21c1
Sequence:CCGGCAACTACAAGGCCATCGAAATCTCGAGATTTCGATGGCCTTGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025446.3-625s21c1
Sequence:CCGGTACCCTTTCCTGGAACATATTCTCGAGAATATGTTCCAGGAAAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025446.3-868s21c1
Sequence:CCGGGGTGATCTGAATCGGACATATCTCGAGATATGTCCGATTCAGATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025446
VALIDATED
AIG1 MISSION shRNA shRNA Plasmid DNA
androgen-induced 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-724s1c1
Sequence:CCGGCTAAACAGCTATATCTGGGATCTCGAGATCCCAGATATAGCTGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-600s1c1
Sequence:CCGGGATACATCATGTCACCGGCATCTCGAGATGCCGGTGACATGATGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-106s1c1
Sequence:CCGGGTAGCAATCCTGCTATCCTATCTCGAGATAGGATAGCAGGATTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025446.1-896s1c1
Sequence:CCGGCTTTCAGAGAGATTTGGGCATCTCGAGATGCCCAAATCTCTCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-562s21c1
Sequence:CCGGACCTTCTCCGTGGGCTATATACTCGAGTATATAGCCCACGGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-402s21c1
Sequence:CCGGCTATGACAGAGAGATGATATACTCGAGTATATCATCTCTCTGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-138s21c1
Sequence:CCGGCAACTACAAGGCCATCGAAATCTCGAGATTTCGATGGCCTTGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025446.3-625s21c1
Sequence:CCGGTACCCTTTCCTGGAACATATTCTCGAGAATATGTTCCAGGAAAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025446.3-868s21c1
Sequence:CCGGGGTGATCTGAATCGGACATATCTCGAGATATGTCCGATTCAGATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025446
VALIDATED
AIG1 MISSION shRNA Lentiviral Transduction Particles
androgen-induced 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-724s1c1
Sequence:CCGGCTAAACAGCTATATCTGGGATCTCGAGATCCCAGATATAGCTGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-600s1c1
Sequence:CCGGGATACATCATGTCACCGGCATCTCGAGATGCCGGTGACATGATGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025446.1-106s1c1
Sequence:CCGGGTAGCAATCCTGCTATCCTATCTCGAGATAGGATAGCAGGATTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025446.1-896s1c1
Sequence:CCGGCTTTCAGAGAGATTTGGGCATCTCGAGATGCCCAAATCTCTCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-562s21c1
Sequence:CCGGACCTTCTCCGTGGGCTATATACTCGAGTATATAGCCCACGGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-402s21c1
Sequence:CCGGCTATGACAGAGAGATGATATACTCGAGTATATCATCTCTCTGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025446.3-138s21c1
Sequence:CCGGCAACTACAAGGCCATCGAAATCTCGAGATTTCGATGGCCTTGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025446.3-625s21c1
Sequence:CCGGTACCCTTTCCTGGAACATATTCTCGAGAATATGTTCCAGGAAAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025446.3-868s21c1
Sequence:CCGGGGTGATCTGAATCGGACATATCTCGAGATATGTCCGATTCAGATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016108
AIG1 MISSION shRNA Bacterial Glycerol Stock
androgen-induced 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-369s1c1
Sequence:CCGGCCTATGACAGAGAGATGATATCTCGAGATATCATCTCTCTGTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016108.2-972s1c1
Sequence:CCGGCCCAAAGTCATTACTGATAATCTCGAGATTATCAGTAATGACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-164s1c1
Sequence:CCGGCTGACGTTCATTGATCTGGTTCTCGAGAACCAGATCAATGAACGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-376s1c1
Sequence:CCGGCAGAGAGATGATATACCCGAACTCGAGTTCGGGTATATCATCTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-100s1c1
Sequence:CCGGCCTGTGTAACTACAAGGCCATCTCGAGATGGCCTTGTAGTTACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-179s1c1
Sequence:CCGGCTGGTTATCCAGGCTGTCTTTCTCGAGAAAGACAGCCTGGATAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-153s1c1
Sequence:CCGGGCTGGAAATTCCTGACGTTCACTCGAGTGAACGTCAGGAATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-70s1c1
Sequence:CCGGGATGGCAATCCTGCTGTCTTACTCGAGTAAGACAGCAGGATTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-477s21c1
Sequence:CCGGGGACATCGCACCATCAGTATCCTCGAGGATACTGATGGTGCGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-443s21c1
Sequence:CCGGACGACGGTTCTGCCCTTTATACTCGAGTATAAAGGGCAGAACCGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016108.2-767s21c1
Sequence:CCGGCTAAACGCAAGAGCTAGATTGCTCGAGCAATCTAGCTCTTGCGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-348s21c1
Sequence:CCGGCAGTGTTCTGGATCATTTATGCTCGAGCATAAATGATCCAGAACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016108
AIG1 MISSION shRNA shRNA Plasmid DNA
androgen-induced 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-369s1c1
Sequence:CCGGCCTATGACAGAGAGATGATATCTCGAGATATCATCTCTCTGTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016108.2-972s1c1
Sequence:CCGGCCCAAAGTCATTACTGATAATCTCGAGATTATCAGTAATGACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-164s1c1
Sequence:CCGGCTGACGTTCATTGATCTGGTTCTCGAGAACCAGATCAATGAACGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-376s1c1
Sequence:CCGGCAGAGAGATGATATACCCGAACTCGAGTTCGGGTATATCATCTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-100s1c1
Sequence:CCGGCCTGTGTAACTACAAGGCCATCTCGAGATGGCCTTGTAGTTACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-179s1c1
Sequence:CCGGCTGGTTATCCAGGCTGTCTTTCTCGAGAAAGACAGCCTGGATAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-153s1c1
Sequence:CCGGGCTGGAAATTCCTGACGTTCACTCGAGTGAACGTCAGGAATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-70s1c1
Sequence:CCGGGATGGCAATCCTGCTGTCTTACTCGAGTAAGACAGCAGGATTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-477s21c1
Sequence:CCGGGGACATCGCACCATCAGTATCCTCGAGGATACTGATGGTGCGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-443s21c1
Sequence:CCGGACGACGGTTCTGCCCTTTATACTCGAGTATAAAGGGCAGAACCGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016108.2-767s21c1
Sequence:CCGGCTAAACGCAAGAGCTAGATTGCTCGAGCAATCTAGCTCTTGCGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-348s21c1
Sequence:CCGGCAGTGTTCTGGATCATTTATGCTCGAGCATAAATGATCCAGAACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016108
AIG1 MISSION shRNA Lentiviral Transduction Particles
androgen-induced 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-369s1c1
Sequence:CCGGCCTATGACAGAGAGATGATATCTCGAGATATCATCTCTCTGTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016108.2-972s1c1
Sequence:CCGGCCCAAAGTCATTACTGATAATCTCGAGATTATCAGTAATGACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-164s1c1
Sequence:CCGGCTGACGTTCATTGATCTGGTTCTCGAGAACCAGATCAATGAACGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-376s1c1
Sequence:CCGGCAGAGAGATGATATACCCGAACTCGAGTTCGGGTATATCATCTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-100s1c1
Sequence:CCGGCCTGTGTAACTACAAGGCCATCTCGAGATGGCCTTGTAGTTACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016108.2-179s1c1
Sequence:CCGGCTGGTTATCCAGGCTGTCTTTCTCGAGAAAGACAGCCTGGATAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-153s1c1
Sequence:CCGGGCTGGAAATTCCTGACGTTCACTCGAGTGAACGTCAGGAATTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016108.2-70s1c1
Sequence:CCGGGATGGCAATCCTGCTGTCTTACTCGAGTAAGACAGCAGGATTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-477s21c1
Sequence:CCGGGGACATCGCACCATCAGTATCCTCGAGGATACTGATGGTGCGATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-443s21c1
Sequence:CCGGACGACGGTTCTGCCCTTTATACTCGAGTATAAAGGGCAGAACCGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016108.2-767s21c1
Sequence:CCGGCTAAACGCAAGAGCTAGATTGCTCGAGCAATCTAGCTCTTGCGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016108.2-348s21c1
Sequence:CCGGCAGTGTTCTGGATCATTTATGCTCGAGCATAAATGATCCAGAACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)