EMAIL THIS PAGE TO A FRIEND

AIM1

absent in melanoma 1

Synonyms: CRYBG1 ST4
UniProtKB ID: Q9Y4K1, O00296, Q5VWJ2
Gene ID:
Mouse(11630) absent in melanoma 1
Rat(309866) absent in melanoma 1
Thale Cress(829022) fatty acid beta-oxidation multifunctional protein AIM1
domestic cat(101096652) absent in melanoma 1
cow(526200) absent in melanoma 1
Horse(100066371) absent in melanoma 1
dog(475012) absent in melanoma 1
chicken(421783) absent in melanoma 1
naked mole-rat(101707258) absent in melanoma 1
domestic guinea pig(100727288) absent in melanoma 1
sheep(101109711) absent in melanoma 1
Domestic Rabbit(100343063) absent in melanoma 1
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001624 Rosetta Predictions human pricing
XM_001067657 Rosetta Predictions rat pricing
XM_241718 Rosetta Predictions rat pricing
NM_172393 Rosetta Predictions mouse pricing
XM_894444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233582 predicted 4406
2 SASI_Hs01_00233583 predicted 4870
3 SASI_Hs01_00233584 predicted 5179
4 SASI_Hs01_00233585 predicted 4549
5 SASI_Hs01_00233586 predicted 3411
6 SASI_Hs01_00233587 predicted 1573
7 SASI_Hs02_00332186 predicted 4180
8 SASI_Hs01_00233588 predicted 4483
9 SASI_Hs02_00332187 predicted 4538
10 SASI_Hs01_00233590 predicted 3796
11 SASI_Hs01_00233581 predicted 2287
12 SASI_Hs01_00233589 predicted 3657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321732 predicted 2630
2 SASI_Rn02_00321733 predicted 5589
3 SASI_Rn02_00321734 predicted 4594
4 SASI_Rn02_00321735 predicted 3979
5 SASI_Rn02_00321736 predicted 1741
6 SASI_Rn02_00321737 predicted 5371
7 SASI_Rn02_00321738 predicted 5078
8 SASI_Rn02_00321739 predicted 5159
9 SASI_Rn02_00321740 predicted 4953
10 SASI_Rn02_00321741 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_241718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146950 predicted 873
2 SASI_Rn01_00146951 predicted 404
3 SASI_Rn01_00146952 predicted 832
4 SASI_Rn01_00146953 predicted 376
5 SASI_Rn01_00146954 predicted 638
6 SASI_Rn01_00146955 predicted 571
7 SASI_Rn01_00146956 predicted 1002
8 SASI_Rn01_00146957 predicted 1063
9 SASI_Rn01_00146958 predicted 1103
10 SASI_Rn01_00146959 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343830 predicted 926
2 SASI_Mm02_00343831 predicted 4705
3 SASI_Mm02_00343832 predicted 4000
4 SASI_Mm02_00343833 predicted 3100
5 SASI_Mm02_00343834 predicted 5105
6 SASI_Mm02_00343835 predicted 4924
7 SASI_Mm02_00343836 predicted 3182
8 SASI_Mm02_00343837 predicted 4684
9 SASI_Mm02_00343838 predicted 4811
10 SASI_Mm02_00343839 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279310 predicted 1133
2 SASI_Mm01_00279311 predicted 4910
3 SASI_Mm01_00279312 predicted 3302
4 SASI_Mm01_00279313 predicted 5309
5 SASI_Mm01_00279314 predicted 5125
6 SASI_Mm01_00279315 predicted 3394
7 SASI_Mm01_00279316 predicted 4896
8 SASI_Mm01_00279317 predicted 5013
9 SASI_Mm01_00279318 predicted 1808
10 SASI_Mm01_00279319 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172393
AIM1 MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1824s1c1
Sequence:CCGGCCTGAAGTCTCTTCGCTTTATCTCGAGATAAAGCGAAGAGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-920s1c1
Sequence:CCGGCTGACCTATCCTTCTGGGATACTCGAGTATCCCAGAAGGATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1361s1c1
Sequence:CCGGCCAGTATTGATGTGTTGGGAACTCGAGTTCCCAACACATCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1287s1c1
Sequence:CCGGGCGGCCTATATTAAGTGATTTCTCGAGAAATCACTTAATATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172393.1-2643s1c1
Sequence:CCGGCGGCAGACAGAATCATCTCAACTCGAGTTGAGATGATTCTGTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172393
AIM1 MISSION shRNA shRNA Plasmid DNA
absent in melanoma 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1824s1c1
Sequence:CCGGCCTGAAGTCTCTTCGCTTTATCTCGAGATAAAGCGAAGAGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-920s1c1
Sequence:CCGGCTGACCTATCCTTCTGGGATACTCGAGTATCCCAGAAGGATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1361s1c1
Sequence:CCGGCCAGTATTGATGTGTTGGGAACTCGAGTTCCCAACACATCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1287s1c1
Sequence:CCGGGCGGCCTATATTAAGTGATTTCTCGAGAAATCACTTAATATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172393.1-2643s1c1
Sequence:CCGGCGGCAGACAGAATCATCTCAACTCGAGTTGAGATGATTCTGTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172393
AIM1 MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1824s1c1
Sequence:CCGGCCTGAAGTCTCTTCGCTTTATCTCGAGATAAAGCGAAGAGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-920s1c1
Sequence:CCGGCTGACCTATCCTTCTGGGATACTCGAGTATCCCAGAAGGATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1361s1c1
Sequence:CCGGCCAGTATTGATGTGTTGGGAACTCGAGTTCCCAACACATCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172393.1-1287s1c1
Sequence:CCGGGCGGCCTATATTAAGTGATTTCTCGAGAAATCACTTAATATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172393.1-2643s1c1
Sequence:CCGGCGGCAGACAGAATCATCTCAACTCGAGTTGAGATGATTCTGTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001624
AIM1 MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1670s1c1
Sequence:CCGGGCTCTGATTCCTGTCAAGGATCTCGAGATCCTTGACAGGAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2479s1c1
Sequence:CCGGGCCAGATCAGACTGTTACAAACTCGAGTTTGTAACAGTCTGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-5099s1c1
Sequence:CCGGGTTCAGGTTATTGGTGGCATACTCGAGTATGCCACCAATAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-3486s1c1
Sequence:CCGGGAATGTCATTATCAGACACAACTCGAGTTGTGTCTGATAATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001624.1-6799s1c1
Sequence:CCGGCCTAATTTCTTGTCCTCCTATCTCGAGATAGGAGGACAAGAAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4727s1c1
Sequence:CCGGCGAAATCAGATTCACTTGTTTCTCGAGAAACAAGTGAATCTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001624.1-6204s1c1
Sequence:CCGGGCCTTAGGTATTCACACATTTCTCGAGAAATGTGTGAATACCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4680s1c1
Sequence:CCGGCTTCTGTTCAACCTATATGTTCTCGAGAACATATAGGTTGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1782s1c1
Sequence:CCGGCCACTGTGGATACCAAAGATTCTCGAGAATCTTTGGTATCCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2941s1c1
Sequence:CCGGCGTCACAAATGGTGGCATTAACTCGAGTTAATGCCACCATTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001624
AIM1 MISSION shRNA shRNA Plasmid DNA
absent in melanoma 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1670s1c1
Sequence:CCGGGCTCTGATTCCTGTCAAGGATCTCGAGATCCTTGACAGGAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2479s1c1
Sequence:CCGGGCCAGATCAGACTGTTACAAACTCGAGTTTGTAACAGTCTGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-5099s1c1
Sequence:CCGGGTTCAGGTTATTGGTGGCATACTCGAGTATGCCACCAATAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-3486s1c1
Sequence:CCGGGAATGTCATTATCAGACACAACTCGAGTTGTGTCTGATAATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001624.1-6799s1c1
Sequence:CCGGCCTAATTTCTTGTCCTCCTATCTCGAGATAGGAGGACAAGAAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4727s1c1
Sequence:CCGGCGAAATCAGATTCACTTGTTTCTCGAGAAACAAGTGAATCTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001624.1-6204s1c1
Sequence:CCGGGCCTTAGGTATTCACACATTTCTCGAGAAATGTGTGAATACCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4680s1c1
Sequence:CCGGCTTCTGTTCAACCTATATGTTCTCGAGAACATATAGGTTGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1782s1c1
Sequence:CCGGCCACTGTGGATACCAAAGATTCTCGAGAATCTTTGGTATCCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2941s1c1
Sequence:CCGGCGTCACAAATGGTGGCATTAACTCGAGTTAATGCCACCATTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001624
AIM1 MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1670s1c1
Sequence:CCGGGCTCTGATTCCTGTCAAGGATCTCGAGATCCTTGACAGGAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2479s1c1
Sequence:CCGGGCCAGATCAGACTGTTACAAACTCGAGTTTGTAACAGTCTGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-5099s1c1
Sequence:CCGGGTTCAGGTTATTGGTGGCATACTCGAGTATGCCACCAATAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-3486s1c1
Sequence:CCGGGAATGTCATTATCAGACACAACTCGAGTTGTGTCTGATAATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001624.1-6799s1c1
Sequence:CCGGCCTAATTTCTTGTCCTCCTATCTCGAGATAGGAGGACAAGAAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4727s1c1
Sequence:CCGGCGAAATCAGATTCACTTGTTTCTCGAGAAACAAGTGAATCTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001624.1-6204s1c1
Sequence:CCGGGCCTTAGGTATTCACACATTTCTCGAGAAATGTGTGAATACCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001624.1-4680s1c1
Sequence:CCGGCTTCTGTTCAACCTATATGTTCTCGAGAACATATAGGTTGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-1782s1c1
Sequence:CCGGCCACTGTGGATACCAAAGATTCTCGAGAATCTTTGGTATCCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001624.1-2941s1c1
Sequence:CCGGCGTCACAAATGGTGGCATTAACTCGAGTTAATGCCACCATTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks