EMAIL THIS PAGE TO A FRIEND

AIM1L

absent in melanoma 1-like

140 Gene Product Result for
Synonyms: CRYBG2
UniProtKB ID: Q8N1P7, B2RNG3, Q5T137, Q5T150
Gene ID:
Mouse(230806) absent in melanoma 1-like
Rat(298543) absent in melanoma 1-like
chicken(419544) absent in melanoma 1-like
dog(612166) uncharacterized LOC612166
dog(487355) absent in melanoma 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217441 MISSION® esiRNA esiRNA targeting human AIM1L human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039775 Rosetta Predictions human pricing
NM_017977 Rosetta Predictions human pricing
XM_001066449 Rosetta Predictions rat pricing
XM_216539 Rosetta Predictions rat pricing
XM_131754 Rosetta Predictions mouse pricing
XM_900443 Rosetta Predictions mouse pricing
XM_900447 Rosetta Predictions mouse pricing
XM_900451 Rosetta Predictions mouse pricing
XM_915853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039965 predicted 2149
2 SASI_Hs01_00039966 predicted 1256
3 SASI_Hs01_00039968 predicted 1986
4 SASI_Hs01_00039969 predicted 744
5 SASI_Hs01_00039970 predicted 1794
6 SASI_Hs01_00039971 predicted 1141
7 SASI_Hs01_00039972 predicted 1250
8 SASI_Hs01_00039973 predicted 1705
9 SASI_Hs01_00039974 predicted 1019
10 SASI_Hs02_00308671 predicted 1588
11 SASI_Hs01_00039967 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150358 predicted 427
2 SASI_Hs01_00150359 predicted 1473
3 SASI_Hs01_00150360 predicted 733
4 SASI_Hs01_00150361 predicted 332
5 SASI_Hs01_00150362 predicted 341
6 SASI_Hs01_00150363 predicted 694
7 SASI_Hs01_00150364 predicted 400
8 SASI_Hs01_00150365 predicted 1412
9 SASI_Hs01_00150366 predicted 554
10 SASI_Hs01_00150367 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317474 predicted 1811
2 SASI_Rn02_00317475 predicted 4104
3 SASI_Rn02_00317476 predicted 1619
4 SASI_Rn02_00317477 predicted 3994
5 SASI_Rn02_00317478 predicted 1458
6 SASI_Rn02_00317479 predicted 4061
7 SASI_Rn02_00317480 predicted 1223
8 SASI_Rn02_00317481 predicted 5008
9 SASI_Rn02_00317482 predicted 1673
10 SASI_Rn02_00317483 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376640 predicted 1813
2 SASI_Rn02_00376641 predicted 739
3 SASI_Rn02_00376642 predicted 1619
4 SASI_Rn02_00376643 predicted 1227
5 SASI_Rn02_00376644 predicted 1674
6 SASI_Rn02_00376645 predicted 2299
7 SASI_Rn02_00376646 predicted 3751
8 SASI_Rn02_00376647 predicted 5381
9 SASI_Rn02_00376648 predicted 1131
10 SASI_Rn02_00376649 predicted 5164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424429 predicted 2784
2 SASI_Mm02_00424430 predicted 2713
3 SASI_Mm02_00424431 predicted 2914
4 SASI_Mm02_00424432 predicted 2937
5 SASI_Mm02_00424433 predicted 2964
6 SASI_Mm02_00424434 predicted 2735
7 SASI_Mm02_00424435 predicted 2959
8 SASI_Mm02_00424436 predicted 2753
9 SASI_Mm02_00424437 predicted 2979
10 SASI_Mm02_00424438 predicted 3002
11 SASI_Mm01_00233241 predicted 2451
12 SASI_Mm01_00233242 predicted 1149
13 SASI_Mm01_00233243 predicted 532
14 SASI_Mm01_00233244 predicted 719
15 SASI_Mm01_00233245 predicted 287
16 SASI_Mm01_00233246 predicted 887
17 SASI_Mm01_00233247 predicted 3368
18 SASI_Mm01_00233248 predicted 4088
19 SASI_Mm01_00233249 predicted 3596
20 SASI_Mm01_00233250 predicted 3780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265432 predicted 365
2 SASI_Mm01_00265433 predicted 357
3 SASI_Mm01_00265434 predicted 355
4 SASI_Mm01_00265435 predicted 387
5 SASI_Mm01_00265436 predicted 370
6 SASI_Mm01_00265437 predicted 364
7 SASI_Mm01_00265438 predicted 344
8 SASI_Mm01_00265439 predicted 359
9 SASI_Mm01_00265440 predicted 388
10 SASI_Mm01_00265441 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223341 predicted 2418
2 SASI_Mm01_00223342 predicted 2293
3 SASI_Mm01_00223343 predicted 2467
4 SASI_Mm01_00223344 predicted 2454
5 SASI_Mm01_00223345 predicted 2459
6 SASI_Mm01_00223346 predicted 2334
7 SASI_Mm01_00223347 predicted 2378
8 SASI_Mm01_00223348 predicted 2416
9 SASI_Mm01_00223349 predicted 2424
10 SASI_Mm01_00223350 predicted 2381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230021 predicted 840
2 SASI_Mm01_00230022 predicted 902
3 SASI_Mm01_00230023 predicted 885
4 SASI_Mm01_00230024 predicted 887
5 SASI_Mm01_00230025 predicted 626
6 SASI_Mm01_00230026 predicted 479
7 SASI_Mm01_00230027 predicted 635
8 SASI_Mm01_00230028 predicted 854
9 SASI_Mm01_00230029 predicted 808
10 SASI_Mm01_00230030 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439792 predicted 2445
2 SASI_Mm02_00439793 predicted 1140
3 SASI_Mm02_00439794 predicted 522
4 SASI_Mm02_00439795 predicted 710
5 SASI_Mm02_00439796 predicted 880
6 SASI_Mm02_00439797 predicted 3356
7 SASI_Mm02_00439798 predicted 4087
8 SASI_Mm02_00439799 predicted 3597
9 SASI_Mm02_00439800 predicted 3775
10 SASI_Mm02_00439801 predicted 3227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017977
AIM1L MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-189s1c1
Sequence:CCGGCCAAGTGGTAAGTGCCACATTCTCGAGAATGTGGCACTTACCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-1472s1c1
Sequence:CCGGCCCAAGGAATAAGTTTGTTCACTCGAGTGAACAAACTTATTCCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-300s1c1
Sequence:CCGGGCAGAAGGAGATGTTTGAGTTCTCGAGAACTCAAACATCTCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-334s1c1
Sequence:CCGGGAAGTGGAAGTCAATGGCTTTCTCGAGAAAGCCATTGACTTCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-855s1c1
Sequence:CCGGGAAAGTGCTAAGTAACCTCGTCTCGAGACGAGGTTACTTAGCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-361s1c1
Sequence:CCGGCAGGAAGAAGAGACTGTGAATCTCGAGATTCACAGTCTCTTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-328s1c1
Sequence:CCGGCGAGAGGAAGTGGAAGTCAATCTCGAGATTGACTTCCACTTCCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-995s1c1
Sequence:CCGGCAGCAGAGCTTAAAGACAGCTCTCGAGAGCTGTCTTTAAGCTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-997s1c1
Sequence:CCGGGCAGAGCTTAAAGACAGCTCTCTCGAGAGAGCTGTCTTTAAGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017977
AIM1L MISSION shRNA shRNA Plasmid DNA
absent in melanoma 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-189s1c1
Sequence:CCGGCCAAGTGGTAAGTGCCACATTCTCGAGAATGTGGCACTTACCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-1472s1c1
Sequence:CCGGCCCAAGGAATAAGTTTGTTCACTCGAGTGAACAAACTTATTCCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-300s1c1
Sequence:CCGGGCAGAAGGAGATGTTTGAGTTCTCGAGAACTCAAACATCTCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-334s1c1
Sequence:CCGGGAAGTGGAAGTCAATGGCTTTCTCGAGAAAGCCATTGACTTCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-855s1c1
Sequence:CCGGGAAAGTGCTAAGTAACCTCGTCTCGAGACGAGGTTACTTAGCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-361s1c1
Sequence:CCGGCAGGAAGAAGAGACTGTGAATCTCGAGATTCACAGTCTCTTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-328s1c1
Sequence:CCGGCGAGAGGAAGTGGAAGTCAATCTCGAGATTGACTTCCACTTCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-995s1c1
Sequence:CCGGCAGCAGAGCTTAAAGACAGCTCTCGAGAGCTGTCTTTAAGCTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-997s1c1
Sequence:CCGGGCAGAGCTTAAAGACAGCTCTCTCGAGAGAGCTGTCTTTAAGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017977
AIM1L MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-189s1c1
Sequence:CCGGCCAAGTGGTAAGTGCCACATTCTCGAGAATGTGGCACTTACCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-1472s1c1
Sequence:CCGGCCCAAGGAATAAGTTTGTTCACTCGAGTGAACAAACTTATTCCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-300s1c1
Sequence:CCGGGCAGAAGGAGATGTTTGAGTTCTCGAGAACTCAAACATCTCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-334s1c1
Sequence:CCGGGAAGTGGAAGTCAATGGCTTTCTCGAGAAAGCCATTGACTTCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-855s1c1
Sequence:CCGGGAAAGTGCTAAGTAACCTCGTCTCGAGACGAGGTTACTTAGCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-361s1c1
Sequence:CCGGCAGGAAGAAGAGACTGTGAATCTCGAGATTCACAGTCTCTTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-328s1c1
Sequence:CCGGCGAGAGGAAGTGGAAGTCAATCTCGAGATTGACTTCCACTTCCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-995s1c1
Sequence:CCGGCAGCAGAGCTTAAAGACAGCTCTCGAGAGCTGTCTTTAAGCTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017977.1-997s1c1
Sequence:CCGGGCAGAGCTTAAAGACAGCTCTCTCGAGAGAGCTGTCTTTAAGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162970
AIM1L MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3065s21c1
Sequence:CCGGTATCCTAGAGCCCGGAGAATACTCGAGTATTCTCCGGGCTCTAGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3366s21c1
Sequence:CCGGCTACTAGAAGAGGGCGAATATCTCGAGATATTCGCCCTCTTCTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3772s21c1
Sequence:CCGGACTTTCTGGGCGACCACATTTCTCGAGAAATGTGGTCGCCCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-2744s21c1
Sequence:CCGGCCGAGGCTGCTGGATACTATACTCGAGTATAGTATCCAGCAGCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-4250s21c1
Sequence:CCGGCAAACAGCGCCGAGCCTATTTCTCGAGAAATAGGCTCGGCGCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162970
AIM1L MISSION shRNA shRNA Plasmid DNA
absent in melanoma 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3065s21c1
Sequence:CCGGTATCCTAGAGCCCGGAGAATACTCGAGTATTCTCCGGGCTCTAGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3366s21c1
Sequence:CCGGCTACTAGAAGAGGGCGAATATCTCGAGATATTCGCCCTCTTCTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3772s21c1
Sequence:CCGGACTTTCTGGGCGACCACATTTCTCGAGAAATGTGGTCGCCCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-2744s21c1
Sequence:CCGGCCGAGGCTGCTGGATACTATACTCGAGTATAGTATCCAGCAGCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-4250s21c1
Sequence:CCGGCAAACAGCGCCGAGCCTATTTCTCGAGAAATAGGCTCGGCGCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162970
AIM1L MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3065s21c1
Sequence:CCGGTATCCTAGAGCCCGGAGAATACTCGAGTATTCTCCGGGCTCTAGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3366s21c1
Sequence:CCGGCTACTAGAAGAGGGCGAATATCTCGAGATATTCGCCCTCTTCTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-3772s21c1
Sequence:CCGGACTTTCTGGGCGACCACATTTCTCGAGAAATGTGGTCGCCCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-2744s21c1
Sequence:CCGGCCGAGGCTGCTGGATACTATACTCGAGTATAGTATCCAGCAGCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162970.1-4250s21c1
Sequence:CCGGCAAACAGCGCCGAGCCTATTTCTCGAGAAATAGGCTCGGCGCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)