EMAIL THIS PAGE TO A FRIEND

AIM2

absent in melanoma 2

73 Gene Product Result for
Synonyms: PYHIN4
UniProtKB ID: O14862, A8K7M7, Q5T3V9, Q96FG9
Gene ID:
Human(9447) Summary: AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
Mouse(383619) absent in melanoma 2
Rat(304987) absent in melanoma 2
domestic guinea pig(101788815) absent in melanoma 2
cow(101904922) absent in melanoma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015351 MISSION® esiRNA esiRNA targeting human AIM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004833 Rosetta Predictions human pricing
XM_001057147 Rosetta Predictions rat pricing
XM_222949 Rosetta Predictions rat pricing
NM_001013779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019302 predicted 426
2 SASI_Hs02_00338405 predicted 325
3 SASI_Hs01_00019304 predicted 1016
4 SASI_Hs01_00019305 predicted 624
5 SASI_Hs01_00019306 predicted 582
6 SASI_Hs01_00019307 predicted 537
7 SASI_Hs01_00019309 predicted 375
8 SASI_Hs02_00338406 predicted 541
9 SASI_Hs01_00019310 predicted 626
10 SASI_Hs01_00019311 predicted 885
11 SASI_Hs01_00019303 predicted 1032
12 SASI_Hs01_00019308 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285576 predicted 685
2 SASI_Rn02_00285577 predicted 274
3 SASI_Rn02_00285578 predicted 762
4 SASI_Rn02_00285579 predicted 629
5 SASI_Rn02_00285580 predicted 753
6 SASI_Rn02_00285581 predicted 764
7 SASI_Rn02_00285582 predicted 752
8 SASI_Rn02_00285583 predicted 447
9 SASI_Rn02_00285584 predicted 793
10 SASI_Rn02_00285585 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381007 predicted 693
2 SASI_Rn02_00381008 predicted 274
3 SASI_Rn02_00381009 predicted 767
4 SASI_Rn02_00381010 predicted 630
5 SASI_Rn02_00381011 predicted 756
6 SASI_Rn02_00381012 predicted 758
7 SASI_Rn02_00381013 predicted 754
8 SASI_Rn02_00381014 predicted 452
9 SASI_Rn02_00381015 predicted 796
10 SASI_Rn02_00381016 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287333 predicted 678
2 SASI_Mm02_00287334 predicted 1139
3 SASI_Mm02_00287335 predicted 1306
4 SASI_Mm02_00287336 predicted 1506
5 SASI_Mm02_00287337 predicted 1305
6 SASI_Mm02_00287338 predicted 974
7 SASI_Mm02_00287339 predicted 725
8 SASI_Mm02_00287340 predicted 1510
9 SASI_Mm02_00287341 predicted 984
10 SASI_Mm02_00287342 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004833
AIM2 MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004833.1-1135s21c1
Sequence:CCGGGAAACGAGGACACAATGAAATCTCGAGATTTCATTGTGTCCTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004833.1-1302s1c1
Sequence:CCGGCCAACTGGTCTAAGCAGCATTCTCGAGAATGCTGCTTAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-542s1c1
Sequence:CCGGGCCACTAAGTCAAGCTGAAATCTCGAGATTTCAGCTTGACTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-959s1c1
Sequence:CCGGCCCGCTGAACATTATCAGAAACTCGAGTTTCTGATAATGTTCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-1228s1c1
Sequence:CCGGCTGGAGTTCATAGCACCATAACTCGAGTTATGGTGCTATGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-541s1c1
Sequence:CCGGAGCCACTAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004833
AIM2 MISSION shRNA shRNA Plasmid DNA
absent in melanoma 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004833.1-1135s21c1
Sequence:CCGGGAAACGAGGACACAATGAAATCTCGAGATTTCATTGTGTCCTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004833.1-1302s1c1
Sequence:CCGGCCAACTGGTCTAAGCAGCATTCTCGAGAATGCTGCTTAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-542s1c1
Sequence:CCGGGCCACTAAGTCAAGCTGAAATCTCGAGATTTCAGCTTGACTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-959s1c1
Sequence:CCGGCCCGCTGAACATTATCAGAAACTCGAGTTTCTGATAATGTTCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-1228s1c1
Sequence:CCGGCTGGAGTTCATAGCACCATAACTCGAGTTATGGTGCTATGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-541s1c1
Sequence:CCGGAGCCACTAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004833
AIM2 MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004833.1-1135s21c1
Sequence:CCGGGAAACGAGGACACAATGAAATCTCGAGATTTCATTGTGTCCTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004833.1-1302s1c1
Sequence:CCGGCCAACTGGTCTAAGCAGCATTCTCGAGAATGCTGCTTAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-542s1c1
Sequence:CCGGGCCACTAAGTCAAGCTGAAATCTCGAGATTTCAGCTTGACTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-959s1c1
Sequence:CCGGCCCGCTGAACATTATCAGAAACTCGAGTTTCTGATAATGTTCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-1228s1c1
Sequence:CCGGCTGGAGTTCATAGCACCATAACTCGAGTTATGGTGCTATGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004833.1-541s1c1
Sequence:CCGGAGCCACTAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013779
AIM2 MISSION shRNA Bacterial Glycerol Stock
absent in melanoma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013779.1-1086s1c1
Sequence:CCGGGCTTTGTCTAAGGCTTGGGATCTCGAGATCCCAAGCCTTAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-132s1c1
Sequence:CCGGGCCATGTGGAACAATTGTGAACTCGAGTTCACAATTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-294s1c1
Sequence:CCGGCACGTTCTTTGAGGTGTCAAACTCGAGTTTGACACCTCAAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-59s1c1
Sequence:CCGGCTAACCACGAAGTCCCAAATACTCGAGTATTTGGGACTTCGTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-105s1c1
Sequence:CCGGTCCCAGGATTAGTAAACTGAACTCGAGTTCAGTTTACTAATCCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013779
AIM2 MISSION shRNA shRNA Plasmid DNA
absent in melanoma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013779.1-1086s1c1
Sequence:CCGGGCTTTGTCTAAGGCTTGGGATCTCGAGATCCCAAGCCTTAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-132s1c1
Sequence:CCGGGCCATGTGGAACAATTGTGAACTCGAGTTCACAATTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-294s1c1
Sequence:CCGGCACGTTCTTTGAGGTGTCAAACTCGAGTTTGACACCTCAAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-59s1c1
Sequence:CCGGCTAACCACGAAGTCCCAAATACTCGAGTATTTGGGACTTCGTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-105s1c1
Sequence:CCGGTCCCAGGATTAGTAAACTGAACTCGAGTTCAGTTTACTAATCCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013779
AIM2 MISSION shRNA Lentiviral Transduction Particles
absent in melanoma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013779.1-1086s1c1
Sequence:CCGGGCTTTGTCTAAGGCTTGGGATCTCGAGATCCCAAGCCTTAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-132s1c1
Sequence:CCGGGCCATGTGGAACAATTGTGAACTCGAGTTCACAATTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-294s1c1
Sequence:CCGGCACGTTCTTTGAGGTGTCAAACTCGAGTTTGACACCTCAAAGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-59s1c1
Sequence:CCGGCTAACCACGAAGTCCCAAATACTCGAGTATTTGGGACTTCGTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013779.1-105s1c1
Sequence:CCGGTCCCAGGATTAGTAAACTGAACTCGAGTTCAGTTTACTAATCCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks