EMAIL THIS PAGE TO A FRIEND

AIMP1

aminoacyl tRNA synthetase complex-interacting multifunctional protein 1

81 Gene Product Result for
Synonyms: EMAP2 EMAPII HLD3 SCYE1 p43
UniProtKB ID: Q12904, B3KTR2, B4E1S7, Q6FG28, Q96CQ9
Gene ID:
Human(9255) Summary: The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
Mouse(13722) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Rat(114632) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Zebrafish(562232) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
dog(487893) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
domestic cat(101084875) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
cow(505126) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
chicken(422533) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
domestic guinea pig(100735088) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
naked mole-rat(101716714) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
sheep(101121350) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Domestic Rabbit(100009367) aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502063 Anti-AIMP1 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, pig, bovine, human, mouse
ELISA, western blot pricing
SAB2502064 Anti-AIMP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, pig, human
ELISA, immunohistochemistry, western blot pricing
HPA018476 Anti-AIMP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3501051 Anti-AIMP1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1306345 ANTI-MCA1(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
GW21105 Anti-SCYE1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV40551 Anti-SCYE1 antibody produced in rabbit affinity isolated antibody zebrafish, pig, mouse, canine, bovine, rabbit, human, horse, rabbit, rat, guinea pig
western blot pricing
SAB2102098 Anti-SCYE1 antibody produced in rabbit affinity isolated antibody rat, rabbit, horse, bovine, pig, mouse, zebrafish, rabbit, human,
western blot pricing
WH0009255M2 Monoclonal Anti-SCYE1 antibody produced in mouse clone M1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404695 Monoclonal Anti-SCYE1 antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004757 Rosetta Predictions human pricing
NM_053757 Rosetta Predictions rat pricing
NM_007926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242748 predicted 801
2 SASI_Hs01_00242749 predicted 1013
3 SASI_Hs01_00242750 predicted 883
4 SASI_Hs01_00242751 predicted 770
5 SASI_Hs01_00242752 predicted 966
6 SASI_Hs01_00242753 predicted 922
7 SASI_Hs01_00242755 predicted 785
8 SASI_Hs01_00242756 predicted 1514
9 SASI_Hs01_00242757 predicted 991
10 SASI_Hs02_00338245 predicted 910
11 SASI_Hs01_00242754 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075650 predicted 777
2 SASI_Rn01_00075651 predicted 785
3 SASI_Rn01_00075652 predicted 706
4 SASI_Rn01_00075653 predicted 782
5 SASI_Rn01_00075654 predicted 710
6 SASI_Rn01_00075655 predicted 772
7 SASI_Rn02_00266543 predicted 725
8 SASI_Rn01_00075656 predicted 787
9 SASI_Rn01_00075658 predicted 736
10 SASI_Rn01_00075659 predicted 732
11 SASI_Rn01_00075657 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312755 predicted 885
2 SASI_Mm02_00312756 predicted 794
3 SASI_Mm01_00138439 predicted 882
4 SASI_Mm01_00138441 predicted 886
5 SASI_Mm01_00138442 predicted 882
6 SASI_Mm02_00312757 predicted 776
7 SASI_Mm02_00312758 predicted 219
8 SASI_Mm02_00312759 predicted 782
9 SASI_Mm02_00312760 predicted 775
10 SASI_Mm02_00312761 predicted 781
11 SASI_Mm01_00138440 predicted 722
12 SASI_Mm01_00138443 predicted 845
13 SASI_Mm01_00138444 predicted 726
14 SASI_Mm01_00138445 predicted 749
15 SASI_Mm01_00138446 predicted 844
16 SASI_Mm01_00138447 predicted 689
17 SASI_Mm01_00138448 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007926
VALIDATED
AIMP1 MISSION shRNA Bacterial Glycerol Stock
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-115s1c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-634s1c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-178s1c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-244s1c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-831s1c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-164s21c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-880s21c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-293s21c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-683s21c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-227s21c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007926
VALIDATED
AIMP1 MISSION shRNA shRNA Plasmid DNA
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-115s1c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-634s1c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-178s1c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-244s1c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-831s1c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-164s21c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-880s21c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-293s21c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-683s21c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-227s21c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007926
VALIDATED
AIMP1 MISSION shRNA Lentiviral Transduction Particles
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-115s1c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-634s1c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-178s1c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-244s1c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007926.1-831s1c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-164s21c1
Sequence:CCGGGCGGATCAGATCATCGAATATCTCGAGATATTCGATGATCTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-880s21c1
Sequence:CCGGAGAGCCTGACAAGGAGCTAAACTCGAGTTTAGCTCCTTGTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-293s21c1
Sequence:CCGGGAGCTAAAGCAAGAGCTGATTCTCGAGAATCAGCTCTTGCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-683s21c1
Sequence:CCGGCTGGTGAATCATGTTCCTCTACTCGAGTAGAGGAACATGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007926.2-227s21c1
Sequence:CCGGCAGGCAACAATGAGAGAAGAACTCGAGTTCTTCTCTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004757
VALIDATED
AIMP1 MISSION shRNA Bacterial Glycerol Stock
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004757.2-1584s1c1
Sequence:CCGGCCAGAGTAACCCTGACTAATACTCGAGTATTAGTCAGGGTTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-925s1c1
Sequence:CCGGCAGCCTGATCTTCACACTAATCTCGAGATTAGTGTGAAGATCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-358s1c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-235s1c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004757.2-1583s1c1
Sequence:CCGGGCCAGAGTAACCCTGACTAATCTCGAGATTAGTCAGGGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-930s21c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-1144s21c1
Sequence:CCGGTTCGAATTGGTTGCATCATAACTCGAGTTATGATGCAACCAATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-807s21c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004757.3-1205s21c1
Sequence:CCGGAGAAGTAGATGTCGGAGAAATCTCGAGATTTCTCCGACATCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004757
VALIDATED
AIMP1 MISSION shRNA shRNA Plasmid DNA
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004757.2-1584s1c1
Sequence:CCGGCCAGAGTAACCCTGACTAATACTCGAGTATTAGTCAGGGTTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-925s1c1
Sequence:CCGGCAGCCTGATCTTCACACTAATCTCGAGATTAGTGTGAAGATCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-358s1c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-235s1c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004757.2-1583s1c1
Sequence:CCGGGCCAGAGTAACCCTGACTAATCTCGAGATTAGTCAGGGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-930s21c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-1144s21c1
Sequence:CCGGTTCGAATTGGTTGCATCATAACTCGAGTTATGATGCAACCAATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-807s21c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004757.3-1205s21c1
Sequence:CCGGAGAAGTAGATGTCGGAGAAATCTCGAGATTTCTCCGACATCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004757
VALIDATED
AIMP1 MISSION shRNA Lentiviral Transduction Particles
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004757.2-1584s1c1
Sequence:CCGGCCAGAGTAACCCTGACTAATACTCGAGTATTAGTCAGGGTTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-925s1c1
Sequence:CCGGCAGCCTGATCTTCACACTAATCTCGAGATTAGTGTGAAGATCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-358s1c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004757.2-235s1c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004757.2-1583s1c1
Sequence:CCGGGCCAGAGTAACCCTGACTAATCTCGAGATTAGTCAGGGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-930s21c1
Sequence:CCGGCTGCACGCTAATTCTATGGTTCTCGAGAACCATAGAATTAGCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-1144s21c1
Sequence:CCGGTTCGAATTGGTTGCATCATAACTCGAGTTATGATGCAACCAATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004757.3-807s21c1
Sequence:CCGGGAGAAGAAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004757.3-1205s21c1
Sequence:CCGGAGAAGTAGATGTCGGAGAAATCTCGAGATTTCTCCGACATCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks