EMAIL THIS PAGE TO A FRIEND

AIMP2

aminoacyl tRNA synthetase complex-interacting multifunctional protein 2

63 Gene Product Result for
Synonyms: JTV-1 JTV1 P38
UniProtKB ID: Q13155, Q75MR1, Q96CZ5, Q9P1L2
Gene ID:
Human(7965) Summary: The JTV1 gene is located on chromosome 7p22 flanked by two genes, HRI and PMS2. JTV1 and HRI overlap slightly and are arranged in a tail-to-tail fashion. JTV1 and PMS2 are separated by approximately 200 base pairs and are arranged head-to-head. JTV1 is transcribed in the opposite direction compared to HRI and PMS2. The function of the JTV1 gene product is unknown. [provided by RefSeq, Jul 2008]
Mouse(231872) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Rat(288480) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Zebrafish(406647) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
cow(520979) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
domestic cat(101096777) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
dog(479752) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
chicken(769030) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
sheep(100302342) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
naked mole-rat(101710642) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
domestic guinea pig(100726477) aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006303 Rosetta Predictions human pricing
NM_001037348 Rosetta Predictions rat pricing
XM_001071883 Rosetta Predictions rat pricing
NM_146165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077778 predicted 361
2 SASI_Hs01_00077779 predicted 808
3 SASI_Hs01_00077780 predicted 414
4 SASI_Hs01_00077781 predicted 334
5 SASI_Hs01_00077782 predicted 741
6 SASI_Hs01_00077783 predicted 366
7 SASI_Hs01_00077784 predicted 388
8 SASI_Hs01_00077785 predicted 796
9 SASI_Hs01_00077786 predicted 771
10 SASI_Hs02_00341320 predicted 769
11 SASI_Hs01_00077787 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072147 predicted 382
2 SASI_Rn01_00072148 predicted 199
3 SASI_Rn02_00204382 predicted 750
4 SASI_Rn01_00072149 predicted 505
5 SASI_Rn02_00204383 predicted 330
6 SASI_Rn01_00072150 predicted 440
7 SASI_Rn01_00072152 predicted 508
8 SASI_Rn01_00072153 predicted 700
9 SASI_Rn01_00072154 predicted 296
10 SASI_Rn01_00072155 predicted 250
11 SASI_Rn01_00072151 predicted 286
12 SASI_Rn01_00072156 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336866 predicted 999
2 SASI_Rn02_00336867 predicted 915
3 SASI_Rn02_00336868 predicted 745
4 SASI_Rn02_00336869 predicted 742
5 SASI_Rn02_00336870 predicted 681
6 SASI_Rn02_00336871 predicted 754
7 SASI_Rn02_00336872 predicted 953
8 SASI_Rn02_00336873 predicted 871
9 SASI_Rn02_00336874 predicted 716
10 SASI_Rn02_00336875 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172319 predicted 708
2 SASI_Mm01_00172320 predicted 717
3 SASI_Mm01_00172321 predicted 541
4 SASI_Mm01_00172322 predicted 651
5 SASI_Mm01_00172324 predicted 257
6 SASI_Mm02_00341860 predicted 244
7 SASI_Mm01_00172325 predicted 349
8 SASI_Mm01_00172326 predicted 266
9 SASI_Mm01_00172327 predicted 447
10 SASI_Mm01_00172328 predicted 460
11 SASI_Mm01_00172323 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006303
VALIDATED
AIMP2 MISSION shRNA Bacterial Glycerol Stock
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-397s21c1
Sequence:CCGGCGGATGAGCCCACGACTTTAACTCGAGTTAAAGTCGTGGGCTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-921s21c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-817s21c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-371s21c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-817s1c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-740s1c1
Sequence:CCGGCGAAGGGAACATTGCACGTTTCTCGAGAAACGTGCAATGTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-921s1c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-405s1c1
Sequence:CCGGCCCACGACTTTAACCACCAATCTCGAGATTGGTGGTTAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-371s1c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006303
VALIDATED
AIMP2 MISSION shRNA shRNA Plasmid DNA
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-397s21c1
Sequence:CCGGCGGATGAGCCCACGACTTTAACTCGAGTTAAAGTCGTGGGCTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-921s21c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-817s21c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-371s21c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-817s1c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-740s1c1
Sequence:CCGGCGAAGGGAACATTGCACGTTTCTCGAGAAACGTGCAATGTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-921s1c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-405s1c1
Sequence:CCGGCCCACGACTTTAACCACCAATCTCGAGATTGGTGGTTAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-371s1c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006303
VALIDATED
AIMP2 MISSION shRNA Lentiviral Transduction Particles
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-397s21c1
Sequence:CCGGCGGATGAGCCCACGACTTTAACTCGAGTTAAAGTCGTGGGCTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-921s21c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-817s21c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006303.3-371s21c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-817s1c1
Sequence:CCGGGCTGGGTAGATATTGCGATTTCTCGAGAAATCGCAATATCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-740s1c1
Sequence:CCGGCGAAGGGAACATTGCACGTTTCTCGAGAAACGTGCAATGTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-921s1c1
Sequence:CCGGGCTGGGAATGAACTCACCGTACTCGAGTACGGTGAGTTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006303.2-405s1c1
Sequence:CCGGCCCACGACTTTAACCACCAATCTCGAGATTGGTGGTTAAAGTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006303.2-371s1c1
Sequence:CCGGCTTGGATGTAACCAACATAATCTCGAGATTATGTTGGTTACATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146165
VALIDATED
AIMP2 MISSION shRNA Bacterial Glycerol Stock
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-638s21c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-286s21c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-155s21c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-349s21c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-286s1c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-713s1c1
Sequence:CCGGGCCATGTTTCAGCTTCGAGAACTCGAGTTCTCGAAGCTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-638s1c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-155s1c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-349s1c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146165
VALIDATED
AIMP2 MISSION shRNA shRNA Plasmid DNA
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-638s21c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-286s21c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-155s21c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-349s21c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-286s1c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-713s1c1
Sequence:CCGGGCCATGTTTCAGCTTCGAGAACTCGAGTTCTCGAAGCTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-638s1c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-155s1c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-349s1c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146165
VALIDATED
AIMP2 MISSION shRNA Lentiviral Transduction Particles
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-638s21c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-286s21c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-155s21c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146165.1-349s21c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-286s1c1
Sequence:CCGGGCCCACAACTTTAGCCACAAACTCGAGTTTGTGGCTAAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-713s1c1
Sequence:CCGGGCCATGTTTCAGCTTCGAGAACTCGAGTTCTCGAAGCTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-638s1c1
Sequence:CCGGCGTTTCCTGTTCTCTCTGTTTCTCGAGAAACAGAGAGAACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-155s1c1
Sequence:CCGGGCCCTTGAATCTCGCCAAGATCTCGAGATCTTGGCGAGATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146165.1-349s1c1
Sequence:CCGGGCTGAAAGACATTGTGATCAACTCGAGTTGATCACAATGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks