EMAIL THIS PAGE TO A FRIEND

AIP

aryl hydrocarbon receptor interacting protein

57 Gene Product Result for
Synonyms: ARA9 FKBP16 FKBP37 SMTPHN XAP-2 XAP2
Gene ID:
Human(9049) Summary: The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. [provided by RefSeq, Sep 2008]
Mouse(11632) aryl-hydrocarbon receptor-interacting protein
Rat(282827) aryl-hydrocarbon receptor-interacting protein
Zebrafish(334795) aryl hydrocarbon receptor interacting protein
chicken(395123) aryl hydrocarbon receptor interacting protein
domestic cat(101092293) aryl hydrocarbon receptor interacting protein
cow(360190) aryl hydrocarbon receptor interacting protein
Horse(100034148) aryl hydrocarbon receptor interacting protein
dog(610467) aryl hydrocarbon receptor interacting protein
domestic guinea pig(100723913) aryl hydrocarbon receptor interacting protein
naked mole-rat(101700666) aryl hydrocarbon receptor interacting protein
sheep(101119947) aryl hydrocarbon receptor interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35710 Anti-AIP (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, zebrafish, rat, horse, human, mouse, guinea pig, canine
immunohistochemistry, western blot pricing
AV37734 Anti-AIP (AB2) antibody produced in rabbit IgG fraction of antiserum zebrafish, mouse, guinea pig, horse, rat, bovine, canine, human
western blot pricing
AV37219 Anti-AIP (AB3) antibody produced in rabbit IgG fraction of antiserum mouse, horse, rat, guinea pig, bovine, human, canine
western blot pricing
HPA004063 Anti-AIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry pricing
SAB2100082 Anti-AIP antibody produced in rabbit affinity isolated antibody rat, guinea pig, canine, human, horse, bovine
western blot pricing
SAB2105326 Anti-AIP antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse
western blot pricing
HPA050217 Anti-AIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2500044 Anti-AIP/ARA9 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1402442 Monoclonal Anti-AIP antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003977 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003977 Rosetta Predictions human pricing
NM_172327 Rosetta Predictions rat pricing
NM_016666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127395 predicted 294
2 SASI_Hs01_00127396 predicted 615
3 SASI_Hs01_00127397 predicted 643
4 SASI_Hs01_00127398 predicted 365
5 SASI_Hs01_00127399 predicted 779
6 SASI_Hs01_00127400 predicted 879
7 SASI_Hs01_00127401 predicted 475
8 SASI_Hs01_00127402 predicted 554
9 SASI_Hs01_00127403 predicted 412
10 SASI_Hs01_00127404 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111569 predicted 1253
2 SASI_Rn01_00111570 predicted 1242
3 SASI_Rn01_00111571 predicted 1090
4 SASI_Rn01_00111572 predicted 1190
5 SASI_Rn01_00111573 predicted 1237
6 SASI_Rn01_00111574 predicted 854
7 SASI_Rn01_00111575 predicted 1174
8 SASI_Rn01_00111576 predicted 1178
9 SASI_Rn01_00111577 predicted 1179
10 SASI_Rn01_00111578 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182241 predicted 735
2 SASI_Mm01_00182242 predicted 336
3 SASI_Mm01_00182243 predicted 974
4 SASI_Mm01_00182244 predicted 876
5 SASI_Mm02_00323284 predicted 972
6 SASI_Mm02_00323285 predicted 272
7 SASI_Mm01_00182245 predicted 291
8 SASI_Mm01_00182246 predicted 674
9 SASI_Mm01_00182247 predicted 654
10 SASI_Mm01_00182248 predicted 522
11 SASI_Mm01_00182240 predicted 648
12 SASI_Mm01_00182249 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016666
AIP MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-352s1c1
Sequence:CCGGCCGTTATAGATGACAGCCGAACTCGAGTTCGGCTGTCATCTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-936s1c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-392s1c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-980s1c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-901s1c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-980s21c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-392s21c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-901s21c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-936s21c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016666
AIP MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-352s1c1
Sequence:CCGGCCGTTATAGATGACAGCCGAACTCGAGTTCGGCTGTCATCTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-936s1c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-392s1c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-980s1c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-901s1c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-980s21c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-392s21c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-901s21c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-936s21c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016666
AIP MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-352s1c1
Sequence:CCGGCCGTTATAGATGACAGCCGAACTCGAGTTCGGCTGTCATCTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-936s1c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-392s1c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-980s1c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016666.1-901s1c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-980s21c1
Sequence:CCGGCCTCAACAAGTATGATGACAACTCGAGTTGTCATCATACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-392s21c1
Sequence:CCGGGCTCATCGTTGGCAAGAAGTTCTCGAGAACTTCTTGCCAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-901s21c1
Sequence:CCGGCACCACTGCTACTCAACTATTCTCGAGAATAGTTGAGTAGCAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016666.2-936s21c1
Sequence:CCGGGTGGCTCAGGAGTATTATGAACTCGAGTTCATAATACTCCTGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003977
VALIDATED
AIP MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-715s1c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-1060s1c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-390s1c1
Sequence:CCGGCATCAAGCATGTGGTCCTGTACTCGAGTACAGGACCACATGCTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-294s1c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-888s1c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-302s21c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-896s21c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-1068s21c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-723s21c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003977
VALIDATED
AIP MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-715s1c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-1060s1c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-390s1c1
Sequence:CCGGCATCAAGCATGTGGTCCTGTACTCGAGTACAGGACCACATGCTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-294s1c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-888s1c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-302s21c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-896s21c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-1068s21c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-723s21c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003977
VALIDATED
AIP MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-715s1c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-1060s1c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-390s1c1
Sequence:CCGGCATCAAGCATGTGGTCCTGTACTCGAGTACAGGACCACATGCTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-294s1c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003977.1-888s1c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-302s21c1
Sequence:CCGGCATGGAGCTCATCATTGGCAACTCGAGTTGCCAATGATGAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-896s21c1
Sequence:CCGGCCTCAACAAGTACGACGACAACTCGAGTTGTCGTCGTACTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-1068s21c1
Sequence:CCGGCAGAAGGACGAAGAGGACAAACTCGAGTTTGTCCTCTTCGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003977.2-723s21c1
Sequence:CCGGGCCAAGTACTACGATGCCATTCTCGAGAATGGCATCGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks