EMAIL THIS PAGE TO A FRIEND

AIPL1

aryl hydrocarbon receptor interacting protein-like 1

96 Gene Product Result for
Synonyms: AIPL2 LCA4
UniProtKB ID: Q9NZN9, D3DTM4, Q6ZZB6, Q8N6A0, Q9H873, Q9NS10
Gene ID:
Human(23746) Summary: Leber congenital amaurosis (LCA) accounts for at least 5% of all inherited retinal disease and is the most severe inherited retinopathy with the earliest age of onset. Individuals affected with LCA are diagnosed at birth or in the first few months of life with severely impaired vision or blindness, nystagmus and an abnormal or flat electroretinogram. The photoreceptor/pineal -expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, was mapped within the LCA4 candidate region. The protein contains three tetratricopeptide motifs, consistent with nuclear transport or chaperone activity. AIPL1 mutations may cause approximately 20% of recessive LCA. [provided by RefSeq, Jul 2008]
Mouse(114230) aryl hydrocarbon receptor-interacting protein-like 1
Rat(59110) aryl hydrocarbon receptor-interacting protein-like 1
chicken(769785) aryl hydrocarbon receptor interacting protein-like 1
cow(281609) aryl hydrocarbon receptor interacting protein-like 1
domestic cat(101089053) aryl hydrocarbon receptor interacting protein-like 1
dog(489447) aryl hydrocarbon receptor interacting protein-like 1
sheep(101104920) aryl hydrocarbon receptor interacting protein-like 1
naked mole-rat(101707637) aryl hydrocarbon receptor interacting protein-like 1
domestic guinea pig(100722990) aryl hydrocarbon receptor interacting protein-like 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033054 Rosetta Predictions human pricing
NM_001033055 Rosetta Predictions human pricing
NM_014336 Rosetta Predictions human pricing
NM_021590 Rosetta Predictions rat pricing
NM_053245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188731 predicted 570
2 SASI_Hs01_00188732 predicted 655
3 SASI_Hs01_00188733 predicted 863
4 SASI_Hs01_00188734 predicted 643
5 SASI_Hs02_00307985 predicted 651
6 SASI_Hs02_00307986 predicted 582
7 SASI_Hs01_00188735 predicted 867
8 SASI_Hs02_00307987 predicted 923
9 SASI_Hs02_00307988 predicted 722
10 SASI_Hs01_00188739 predicted 598
11 SASI_Hs01_00188736 predicted 752
12 SASI_Hs01_00188737 predicted 784
13 SASI_Hs01_00188738 predicted 735
14 SASI_Hs01_00188740 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224063 predicted 578
2 SASI_Hs01_00224064 predicted 667
3 SASI_Hs01_00224065 predicted 868
4 SASI_Hs01_00224066 predicted 656
5 SASI_Hs02_00307989 predicted 660
6 SASI_Hs02_00307990 predicted 590
7 SASI_Hs01_00224067 predicted 881
8 SASI_Hs02_00307991 predicted 929
9 SASI_Hs02_00307992 predicted 727
10 SASI_Hs01_00224071 predicted 613
11 SASI_Hs01_00224068 predicted 759
12 SASI_Hs01_00224069 predicted 788
13 SASI_Hs01_00224070 predicted 749
14 SASI_Hs01_00224072 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074984 predicted 762
2 SASI_Hs01_00074985 predicted 844
3 SASI_Hs01_00074986 predicted 1045
4 SASI_Hs01_00074987 predicted 830
5 SASI_Hs01_00074988 predicted 1062
6 SASI_Hs01_00074989 predicted 936
7 SASI_Hs01_00074990 predicted 963
8 SASI_Hs01_00074991 predicted 922
9 SASI_Hs01_00074992 predicted 796
10 SASI_Hs01_00074993 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045850 predicted 551
2 SASI_Rn01_00045851 predicted 771
3 SASI_Rn01_00045852 predicted 666
4 SASI_Rn01_00045854 predicted 1184
5 SASI_Rn01_00045855 predicted 1059
6 SASI_Rn01_00045856 predicted 1133
7 SASI_Rn01_00045857 predicted 1193
8 SASI_Rn01_00045858 predicted 845
9 SASI_Rn01_00045859 predicted 397
10 SASI_Rn02_00262633 predicted 1187
11 SASI_Rn01_00045853 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167670 predicted 297
2 SASI_Mm02_00337841 predicted 1306
3 SASI_Mm02_00337842 predicted 1193
4 SASI_Mm02_00337843 predicted 308
5 SASI_Mm01_00167673 predicted 828
6 SASI_Mm02_00337844 predicted 1280
7 SASI_Mm02_00337845 predicted 1318
8 SASI_Mm01_00167674 predicted 420
9 SASI_Mm01_00167675 predicted 400
10 SASI_Mm02_00337846 predicted 1309
11 SASI_Mm01_00167671 predicted 497
12 SASI_Mm01_00167672 predicted 496
13 SASI_Mm01_00167676 predicted 252
14 SASI_Mm01_00167677 predicted 517
15 SASI_Mm01_00167678 predicted 526
16 SASI_Mm01_00167679 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014336
AIPL1 MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor interacting protein-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-232s21c1
Sequence:CCGGGGACAGTCATTGACGACAGTCCTCGAGGACTGTCGTCAATGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1567s21c1
Sequence:CCGGGTCAATGACAAATGAGGATTTCTCGAGAAATCCTCATTTGTCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-818s21c1
Sequence:CCGGGAAGAAGGAGGAGTACTATGACTCGAGTCATAGTACTCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-270s21c1
Sequence:CCGGATGCACATCATCATCGGAAACCTCGAGGTTTCCGATGATGATGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1294s21c1
Sequence:CCGGTGGTCACTTCTGGTTCGATTGCTCGAGCAATCGAACCAGAAGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-571s1c1
Sequence:CCGGCGGAGAGGGAAATCGGCTCTTCTCGAGAAGAGCCGATTTCCCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-842s1c1
Sequence:CCGGGCTCACGCAGAGGTGTGGAATCTCGAGATTCCACACCTCTGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-124s1c1
Sequence:CCGGGATCTTTCATTTCCGCACCATCTCGAGATGGTGCGGAAATGAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-772s1c1
Sequence:CCGGGCTGGAGCACACCAGTGATATCTCGAGATATCACTGGTGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014336
AIPL1 MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor interacting protein-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-232s21c1
Sequence:CCGGGGACAGTCATTGACGACAGTCCTCGAGGACTGTCGTCAATGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1567s21c1
Sequence:CCGGGTCAATGACAAATGAGGATTTCTCGAGAAATCCTCATTTGTCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-818s21c1
Sequence:CCGGGAAGAAGGAGGAGTACTATGACTCGAGTCATAGTACTCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-270s21c1
Sequence:CCGGATGCACATCATCATCGGAAACCTCGAGGTTTCCGATGATGATGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1294s21c1
Sequence:CCGGTGGTCACTTCTGGTTCGATTGCTCGAGCAATCGAACCAGAAGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-571s1c1
Sequence:CCGGCGGAGAGGGAAATCGGCTCTTCTCGAGAAGAGCCGATTTCCCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-842s1c1
Sequence:CCGGGCTCACGCAGAGGTGTGGAATCTCGAGATTCCACACCTCTGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-124s1c1
Sequence:CCGGGATCTTTCATTTCCGCACCATCTCGAGATGGTGCGGAAATGAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-772s1c1
Sequence:CCGGGCTGGAGCACACCAGTGATATCTCGAGATATCACTGGTGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014336
AIPL1 MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor interacting protein-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-232s21c1
Sequence:CCGGGGACAGTCATTGACGACAGTCCTCGAGGACTGTCGTCAATGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1567s21c1
Sequence:CCGGGTCAATGACAAATGAGGATTTCTCGAGAAATCCTCATTTGTCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-818s21c1
Sequence:CCGGGAAGAAGGAGGAGTACTATGACTCGAGTCATAGTACTCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014336.3-270s21c1
Sequence:CCGGATGCACATCATCATCGGAAACCTCGAGGTTTCCGATGATGATGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014336.3-1294s21c1
Sequence:CCGGTGGTCACTTCTGGTTCGATTGCTCGAGCAATCGAACCAGAAGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-571s1c1
Sequence:CCGGCGGAGAGGGAAATCGGCTCTTCTCGAGAAGAGCCGATTTCCCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-842s1c1
Sequence:CCGGGCTCACGCAGAGGTGTGGAATCTCGAGATTCCACACCTCTGCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-124s1c1
Sequence:CCGGGATCTTTCATTTCCGCACCATCTCGAGATGGTGCGGAAATGAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014336.2-772s1c1
Sequence:CCGGGCTGGAGCACACCAGTGATATCTCGAGATATCACTGGTGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053245
AIPL1 MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor interacting protein-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-412s21c1
Sequence:CCGGTGCGGGTTGGCCAACATGTTTCTCGAGAAACATGTTGGCCAACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-836s21c1
Sequence:CCGGGGATCGTGAAGGCCTACTATACTCGAGTATAGTAGGCCTTCACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-228s21c1
Sequence:CCGGGAGCATCATCATCGGCAACATCTCGAGATGTTGCCGATGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-504s1c1
Sequence:CCGGCCTGAATAATGAAGAGAGGATCTCGAGATCCTCTCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-112s1c1
Sequence:CCGGCGAACAATGAAGTGTGATGAACTCGAGTTCATCACACTTCATTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-687s1c1
Sequence:CCGGCAACACCCTGATCCTCAACTACTCGAGTAGTTGAGGATCAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-549s1c1
Sequence:CCGGAGAAGGCAACAGGCTCTACAACTCGAGTTGTAGAGCCTGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-28s1c1
Sequence:CCGGGAGGGTGTCAAGAAGACCATTCTCGAGAATGGTCTTCTTGACACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053245
AIPL1 MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor interacting protein-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-412s21c1
Sequence:CCGGTGCGGGTTGGCCAACATGTTTCTCGAGAAACATGTTGGCCAACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-836s21c1
Sequence:CCGGGGATCGTGAAGGCCTACTATACTCGAGTATAGTAGGCCTTCACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-228s21c1
Sequence:CCGGGAGCATCATCATCGGCAACATCTCGAGATGTTGCCGATGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-504s1c1
Sequence:CCGGCCTGAATAATGAAGAGAGGATCTCGAGATCCTCTCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-112s1c1
Sequence:CCGGCGAACAATGAAGTGTGATGAACTCGAGTTCATCACACTTCATTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-687s1c1
Sequence:CCGGCAACACCCTGATCCTCAACTACTCGAGTAGTTGAGGATCAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-549s1c1
Sequence:CCGGAGAAGGCAACAGGCTCTACAACTCGAGTTGTAGAGCCTGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-28s1c1
Sequence:CCGGGAGGGTGTCAAGAAGACCATTCTCGAGAATGGTCTTCTTGACACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053245
AIPL1 MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor interacting protein-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-412s21c1
Sequence:CCGGTGCGGGTTGGCCAACATGTTTCTCGAGAAACATGTTGGCCAACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-836s21c1
Sequence:CCGGGGATCGTGAAGGCCTACTATACTCGAGTATAGTAGGCCTTCACGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053245.2-228s21c1
Sequence:CCGGGAGCATCATCATCGGCAACATCTCGAGATGTTGCCGATGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-504s1c1
Sequence:CCGGCCTGAATAATGAAGAGAGGATCTCGAGATCCTCTCTTCATTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-112s1c1
Sequence:CCGGCGAACAATGAAGTGTGATGAACTCGAGTTCATCACACTTCATTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-687s1c1
Sequence:CCGGCAACACCCTGATCCTCAACTACTCGAGTAGTTGAGGATCAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-549s1c1
Sequence:CCGGAGAAGGCAACAGGCTCTACAACTCGAGTTGTAGAGCCTGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053245.1-28s1c1
Sequence:CCGGGAGGGTGTCAAGAAGACCATTCTCGAGAATGGTCTTCTTGACACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks