EMAIL THIS PAGE TO A FRIEND

AIRE

autoimmune regulator

68 Gene Product Result for
Synonyms: AIRE1 APECED APS1 APSI PGA1
UniProtKB ID: O43918, B2RP50, O43922, O43932, O75745
Gene ID:
Human(326) Summary: This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
Mouse(11634) autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
Rat(294328) autoimmune regulator
Zebrafish(100007662) autoimmune regulator
cow(784775) autoimmune regulator
domestic cat(101091039) autoimmune regulator
dog(487796) autoimmune regulator
chicken(429666) autoimmune regulator
naked mole-rat(101725873) autoimmune regulator
domestic guinea pig(100729880) autoimmune regulator
sheep(101102698) autoimmune regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32649 Anti-AIRE (AB1) antibody produced in rabbit affinity isolated antibody human, bovine, horse
western blot pricing
AV32650 Anti-AIRE (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rat, bovine, mouse
western blot pricing
SAB2500045 Anti-AIRE (Isoform 1) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, human, bovine
ELISA, immunohistochemistry, western blot pricing
SAB2500046 Anti-AIRE (Isoforms 1 and 2) (AB1) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ChIP, ELISA, western blot pricing
SAB2500047 Anti-AIRE (Isoforms 1 and 2) (AB2) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2100083 Anti-AIRE antibody produced in rabbit affinity isolated antibody human, guinea pig, horse
western blot pricing
SAB2104578 Anti-AIRE antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA038267 Anti-AIRE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501439 Anti-AIRE antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4501440 Anti-AIRE antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
SAB4504687 Anti-phospho-AIRE (pSer156) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301340 Anti-phospho-AIRE (pSer156) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000383 Rosetta Predictions human pricing
NM_000658 Rosetta Predictions human pricing
NM_001106379 Rosetta Predictions rat pricing
NM_009646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147792 predicted 1775
2 SASI_Hs01_00147793 predicted 1290
3 SASI_Hs01_00147794 predicted 1796
4 SASI_Hs01_00147795 predicted 1286
5 SASI_Hs01_00147796 predicted 1386
6 SASI_Hs01_00147797 predicted 1781
7 SASI_Hs01_00147798 predicted 1441
8 SASI_Hs01_00147799 predicted 1639
9 SASI_Hs01_00147800 predicted 1434
10 SASI_Hs01_00147801 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177221 predicted 1289
2 SASI_Hs01_00177222 predicted 805
3 SASI_Hs01_00177223 predicted 1311
4 SASI_Hs01_00177224 predicted 795
5 SASI_Hs01_00177225 predicted 901
6 SASI_Hs01_00177226 predicted 1308
7 SASI_Hs01_00177227 predicted 954
8 SASI_Hs01_00177228 predicted 1155
9 SASI_Hs01_00177229 predicted 950
10 SASI_Hs01_00177230 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218388 predicted 1151
2 SASI_Rn02_00218389 predicted 1382
3 SASI_Rn02_00218390 predicted 1209
4 SASI_Rn02_00218391 predicted 668
5 SASI_Rn02_00218392 predicted 320
6 SASI_Rn02_00218393 predicted 1279
7 SASI_Rn02_00218394 predicted 678
8 SASI_Rn02_00218395 predicted 487
9 SASI_Rn02_00218396 predicted 964
10 SASI_Rn02_00218397 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198569 predicted 697
2 SASI_Mm01_00198570 predicted 290
3 SASI_Mm01_00198571 predicted 319
4 SASI_Mm01_00198572 predicted 1374
5 SASI_Mm01_00198573 predicted 486
6 SASI_Mm02_00316631 predicted 1346
7 SASI_Mm01_00198574 predicted 366
8 SASI_Mm01_00198575 predicted 979
9 SASI_Mm01_00198576 predicted 1683
10 SASI_Mm01_00198577 predicted 1579
11 SASI_Mm01_00198568 predicted 857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009646
AIRE MISSION shRNA Bacterial Glycerol Stock
autoimmune regulator
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009646.1-1776s1c1
Sequence:CCGGCATCGGATGAGGCACTCTGTTCTCGAGAACAGAGTGCCTCATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1691s1c1
Sequence:CCGGCCGAGACACCACCCTTCTCTTCTCGAGAAGAGAAGGGTGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-581s1c1
Sequence:CCGGACCTTCCTCTTGGAAACGGAACTCGAGTTCCGTTTCCAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-776s1c1
Sequence:CCGGCCAGTGGCAATTTGAAGAACACTCGAGTGTTCTTCAAATTGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1632s1c1
Sequence:CCGGTGAGCACTCATTTGACGGCATCTCGAGATGCCGTCAAATGAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009646.1-1457s21c1
Sequence:CCGGGGACCAATCTCCGCTGCAAATCTCGAGATTTGCAGCGGAGATTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009646
AIRE MISSION shRNA shRNA Plasmid DNA
autoimmune regulator
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009646.1-1776s1c1
Sequence:CCGGCATCGGATGAGGCACTCTGTTCTCGAGAACAGAGTGCCTCATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1691s1c1
Sequence:CCGGCCGAGACACCACCCTTCTCTTCTCGAGAAGAGAAGGGTGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-581s1c1
Sequence:CCGGACCTTCCTCTTGGAAACGGAACTCGAGTTCCGTTTCCAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-776s1c1
Sequence:CCGGCCAGTGGCAATTTGAAGAACACTCGAGTGTTCTTCAAATTGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1632s1c1
Sequence:CCGGTGAGCACTCATTTGACGGCATCTCGAGATGCCGTCAAATGAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009646.1-1457s21c1
Sequence:CCGGGGACCAATCTCCGCTGCAAATCTCGAGATTTGCAGCGGAGATTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009646
AIRE MISSION shRNA Lentiviral Transduction Particles
autoimmune regulator
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009646.1-1776s1c1
Sequence:CCGGCATCGGATGAGGCACTCTGTTCTCGAGAACAGAGTGCCTCATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1691s1c1
Sequence:CCGGCCGAGACACCACCCTTCTCTTCTCGAGAAGAGAAGGGTGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-581s1c1
Sequence:CCGGACCTTCCTCTTGGAAACGGAACTCGAGTTCCGTTTCCAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-776s1c1
Sequence:CCGGCCAGTGGCAATTTGAAGAACACTCGAGTGTTCTTCAAATTGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009646.1-1632s1c1
Sequence:CCGGTGAGCACTCATTTGACGGCATCTCGAGATGCCGTCAAATGAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009646.1-1457s21c1
Sequence:CCGGGGACCAATCTCCGCTGCAAATCTCGAGATTTGCAGCGGAGATTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000383
AIRE MISSION shRNA Bacterial Glycerol Stock
autoimmune regulator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-248s1c1
Sequence:CCGGGACAAGTTTCAGGAGACGCTTCTCGAGAAGCGTCTCCTGAAACTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1288s1c1
Sequence:CCGGCATGGACACGACTCTTGTCTACTCGAGTAGACAAGAGTCGTGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1625s1c1
Sequence:CCGGGCCAAGGATGACACTGCCAGTCTCGAGACTGGCAGTGTCATCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-260s1c1
Sequence:CCGGGAGACGCTTCATCTGAAGGAACTCGAGTTCCTTCAGATGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-814s1c1
Sequence:CCGGGTTCTACACTCCCAGCAAGTTCTCGAGAACTTGCTGGGAGTGTAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1924s21c1
Sequence:CCGGCCATCATGTGCCTGGAAATTACTCGAGTAATTTCCAGGCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-378s21c1
Sequence:CCGGACTACAACCTGGAGCGCTATGCTCGAGCATAGCGCTCCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1877s21c1
Sequence:CCGGTTGTCAGTGCTCGGCTGTAAACTCGAGTTTACAGCCGAGCACTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-753s21c1
Sequence:CCGGTCCTCATCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000383
AIRE MISSION shRNA shRNA Plasmid DNA
autoimmune regulator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-248s1c1
Sequence:CCGGGACAAGTTTCAGGAGACGCTTCTCGAGAAGCGTCTCCTGAAACTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1288s1c1
Sequence:CCGGCATGGACACGACTCTTGTCTACTCGAGTAGACAAGAGTCGTGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1625s1c1
Sequence:CCGGGCCAAGGATGACACTGCCAGTCTCGAGACTGGCAGTGTCATCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-260s1c1
Sequence:CCGGGAGACGCTTCATCTGAAGGAACTCGAGTTCCTTCAGATGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-814s1c1
Sequence:CCGGGTTCTACACTCCCAGCAAGTTCTCGAGAACTTGCTGGGAGTGTAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1924s21c1
Sequence:CCGGCCATCATGTGCCTGGAAATTACTCGAGTAATTTCCAGGCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-378s21c1
Sequence:CCGGACTACAACCTGGAGCGCTATGCTCGAGCATAGCGCTCCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1877s21c1
Sequence:CCGGTTGTCAGTGCTCGGCTGTAAACTCGAGTTTACAGCCGAGCACTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-753s21c1
Sequence:CCGGTCCTCATCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000383
AIRE MISSION shRNA Lentiviral Transduction Particles
autoimmune regulator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-248s1c1
Sequence:CCGGGACAAGTTTCAGGAGACGCTTCTCGAGAAGCGTCTCCTGAAACTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1288s1c1
Sequence:CCGGCATGGACACGACTCTTGTCTACTCGAGTAGACAAGAGTCGTGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-1625s1c1
Sequence:CCGGGCCAAGGATGACACTGCCAGTCTCGAGACTGGCAGTGTCATCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-260s1c1
Sequence:CCGGGAGACGCTTCATCTGAAGGAACTCGAGTTCCTTCAGATGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000383.1-814s1c1
Sequence:CCGGGTTCTACACTCCCAGCAAGTTCTCGAGAACTTGCTGGGAGTGTAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1924s21c1
Sequence:CCGGCCATCATGTGCCTGGAAATTACTCGAGTAATTTCCAGGCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-378s21c1
Sequence:CCGGACTACAACCTGGAGCGCTATGCTCGAGCATAGCGCTCCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000383.2-1877s21c1
Sequence:CCGGTTGTCAGTGCTCGGCTGTAAACTCGAGTTTACAGCCGAGCACTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000383.2-753s21c1
Sequence:CCGGTCCTCATCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks