EMAIL THIS PAGE TO A FRIEND

AJAP1

adherens junctions associated protein 1

109 Gene Product Result for
Synonyms: MOT8 RP3-426F10.1 SHREW-1 SHREW1
UniProtKB ID: Q9UKB5, Q9Y229
Gene ID:
Mouse(230959) adherens junction associated protein 1
Rat(687031) adherens junction associated protein 1
Zebrafish(557022) adherens junctions associated protein 1
chicken(770310) adherens junctions associated protein 1
dog(607839) adherens junctions associated protein 1
domestic cat(101092625) adherens junctions associated protein 1
cow(616582) adherens junctions associated protein 1
naked mole-rat(101712467) adherens junctions associated protein 1
domestic guinea pig(100735559) adherens junctions associated protein 1
sheep(101123222) adherens junctions associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042478 Rosetta Predictions human pricing
NM_018836 Rosetta Predictions human pricing
NM_001101014 Rosetta Predictions rat pricing
NM_001099299 Rosetta Predictions mouse pricing
XM_485506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310048 predicted 1395
2 SASI_Hs02_00310049 predicted 1413
3 SASI_Hs02_00310050 predicted 1434
4 SASI_Hs02_00310051 predicted 1361
5 SASI_Hs02_00310052 predicted 1268
6 SASI_Hs02_00310053 predicted 1412
7 SASI_Hs02_00310054 predicted 1405
8 SASI_Hs02_00310055 predicted 1309
9 SASI_Hs02_00310056 predicted 1410
10 SASI_Hs02_00310057 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352284 predicted 1394
2 SASI_Hs02_00352285 predicted 1407
3 SASI_Hs01_00244565 predicted 1432
4 SASI_Hs01_00244566 predicted 1359
5 SASI_Hs01_00244567 predicted 1265
6 SASI_Hs01_00244568 predicted 1409
7 SASI_Hs01_00244569 predicted 1403
8 SASI_Hs01_00244570 predicted 1301
9 SASI_Hs02_00352286 predicted 1413
10 SASI_Hs01_00244572 predicted 1309
11 SASI_Hs01_00244564 predicted 1471
12 SASI_Hs01_00244571 predicted 1463
13 SASI_Hs01_00244573 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211266 predicted 642
2 SASI_Rn02_00211267 predicted 1748
3 SASI_Rn02_00211268 predicted 835
4 SASI_Rn02_00211269 predicted 1096
5 SASI_Rn02_00211270 predicted 628
6 SASI_Rn02_00211271 predicted 1147
7 SASI_Rn02_00211272 predicted 1137
8 SASI_Rn02_00211273 predicted 1038
9 SASI_Rn02_00211274 predicted 719
10 SASI_Rn02_00211275 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301591 predicted 1716
2 SASI_Mm02_00301592 predicted 1738
3 SASI_Mm02_00301593 predicted 1622
4 SASI_Mm02_00301594 predicted 778
5 SASI_Mm02_00301595 predicted 1564
6 SASI_Mm02_00301596 predicted 1734
7 SASI_Mm02_00301597 predicted 1549
8 SASI_Mm02_00301598 predicted 1551
9 SASI_Mm02_00301599 predicted 924
10 SASI_Mm02_00301600 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223360 predicted 1200
2 SASI_Mm01_00223361 predicted 1219
3 SASI_Mm01_00223362 predicted 1219
4 SASI_Mm01_00223363 predicted 1236
5 SASI_Mm01_00223364 predicted 1265
6 SASI_Mm01_00223365 predicted 1134
7 SASI_Mm01_00223366 predicted 1158
8 SASI_Mm01_00223367 predicted 1121
9 SASI_Mm01_00223368 predicted 1152
10 SASI_Mm01_00223369 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018836
AJAP1 MISSION shRNA Bacterial Glycerol Stock
adherens junctions associated protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018836.3-1813s21c1
Sequence:CCGGACGCTCTAGGCCAAATCTATTCTCGAGAATAGATTTGGCCTAGAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1514s21c1
Sequence:CCGGGGGAGTACAAATCCACATTTACTCGAGTAAATGTGGATTTGTACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1413s21c1
Sequence:CCGGGGACATATTCACGGCCTATAACTCGAGTTATAGGCCGTGAATATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018836.2-2077s1c1
Sequence:CCGGCGCAGAGAAATCTTACAGAAACTCGAGTTTCTGTAAGATTTCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1271s1c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-457s1c1
Sequence:CCGGTGGATACTGATAGCCATGTTTCTCGAGAAACATGGCTATCAGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1264s1c1
Sequence:CCGGGCTGCTCTCATCACAACTCTTCTCGAGAAGAGTTGTGATGAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1550s1c1
Sequence:CCGGCCTCTTCTGATCGGCATCTTACTCGAGTAAGATGCCGATCAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018836
AJAP1 MISSION shRNA shRNA Plasmid DNA
adherens junctions associated protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018836.3-1813s21c1
Sequence:CCGGACGCTCTAGGCCAAATCTATTCTCGAGAATAGATTTGGCCTAGAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1514s21c1
Sequence:CCGGGGGAGTACAAATCCACATTTACTCGAGTAAATGTGGATTTGTACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1413s21c1
Sequence:CCGGGGACATATTCACGGCCTATAACTCGAGTTATAGGCCGTGAATATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018836.2-2077s1c1
Sequence:CCGGCGCAGAGAAATCTTACAGAAACTCGAGTTTCTGTAAGATTTCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1271s1c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-457s1c1
Sequence:CCGGTGGATACTGATAGCCATGTTTCTCGAGAAACATGGCTATCAGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1264s1c1
Sequence:CCGGGCTGCTCTCATCACAACTCTTCTCGAGAAGAGTTGTGATGAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1550s1c1
Sequence:CCGGCCTCTTCTGATCGGCATCTTACTCGAGTAAGATGCCGATCAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018836
AJAP1 MISSION shRNA Lentiviral Transduction Particles
adherens junctions associated protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018836.3-1813s21c1
Sequence:CCGGACGCTCTAGGCCAAATCTATTCTCGAGAATAGATTTGGCCTAGAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1514s21c1
Sequence:CCGGGGGAGTACAAATCCACATTTACTCGAGTAAATGTGGATTTGTACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018836.3-1413s21c1
Sequence:CCGGGGACATATTCACGGCCTATAACTCGAGTTATAGGCCGTGAATATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018836.2-2077s1c1
Sequence:CCGGCGCAGAGAAATCTTACAGAAACTCGAGTTTCTGTAAGATTTCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1271s1c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-457s1c1
Sequence:CCGGTGGATACTGATAGCCATGTTTCTCGAGAAACATGGCTATCAGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1264s1c1
Sequence:CCGGGCTGCTCTCATCACAACTCTTCTCGAGAAGAGTTGTGATGAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018836.2-1550s1c1
Sequence:CCGGCCTCTTCTGATCGGCATCTTACTCGAGTAAGATGCCGATCAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099299
AJAP1 MISSION shRNA Bacterial Glycerol Stock
adherens junctions associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1569s21c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099299.1-2401s21c1
Sequence:CCGGTTCCGGTAGAGTCACTATTTCCTCGAGGAAATAGTGACTCTACCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1712s21c1
Sequence:CCGGGACATCTTCACCGCCTATAATCTCGAGATTATAGGCGGTGAAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-741s21c1
Sequence:CCGGGCCATGCCTGGATACTGATAGCTCGAGCTATCAGTATCCAGGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1153s21c1
Sequence:CCGGTGATACAGAGTTCAACGATTTCTCGAGAAATCGTTGAACTCTGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099299
AJAP1 MISSION shRNA shRNA Plasmid DNA
adherens junctions associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1569s21c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099299.1-2401s21c1
Sequence:CCGGTTCCGGTAGAGTCACTATTTCCTCGAGGAAATAGTGACTCTACCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1712s21c1
Sequence:CCGGGACATCTTCACCGCCTATAATCTCGAGATTATAGGCGGTGAAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-741s21c1
Sequence:CCGGGCCATGCCTGGATACTGATAGCTCGAGCTATCAGTATCCAGGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1153s21c1
Sequence:CCGGTGATACAGAGTTCAACGATTTCTCGAGAAATCGTTGAACTCTGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099299
AJAP1 MISSION shRNA Lentiviral Transduction Particles
adherens junctions associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1569s21c1
Sequence:CCGGTCATCACAACTCTTGTCTTAACTCGAGTTAAGACAAGAGTTGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099299.1-2401s21c1
Sequence:CCGGTTCCGGTAGAGTCACTATTTCCTCGAGGAAATAGTGACTCTACCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1712s21c1
Sequence:CCGGGACATCTTCACCGCCTATAATCTCGAGATTATAGGCGGTGAAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-741s21c1
Sequence:CCGGGCCATGCCTGGATACTGATAGCTCGAGCTATCAGTATCCAGGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099299.1-1153s21c1
Sequence:CCGGTGATACAGAGTTCAACGATTTCTCGAGAAATCGTTGAACTCTGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)