EMAIL THIS PAGE TO A FRIEND

AJUBA

ajuba LIM protein

123 Gene Product Result for
Synonyms: JUB
UniProtKB ID: Q96IF1, A8MX18, D3DS37
Gene ID:
Mouse(16475) ajuba LIM protein
Rat(85265) ajuba LIM protein
Zebrafish(572549) ajuba LIM protein
cow(519937) jub, ajuba homolog (Xenopus laevis)
domestic cat(101092118) ajuba LIM protein
dog(480244) ajuba LIM protein
sheep(101102150) ajuba LIM protein
domestic guinea pig(100730939) ajuba LIM protein
naked mole-rat(101721218) ajuba LIM protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032876 Rosetta Predictions human pricing
NM_198086 Rosetta Predictions human pricing
NM_053503 Rosetta Predictions rat pricing
NM_010590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082629 predicted 1507
2 SASI_Hs01_00082630 predicted 1404
3 SASI_Hs01_00082631 predicted 1834
4 SASI_Hs01_00082632 predicted 1398
5 SASI_Hs02_00360491 predicted 1645
6 SASI_Hs02_00360492 predicted 1522
7 SASI_Hs01_00082633 predicted 2252
8 SASI_Hs01_00082636 predicted 1516
9 SASI_Hs01_00082637 predicted 594
10 SASI_Hs02_00360493 predicted 2246
11 SASI_Hs01_00082634 predicted 2130
12 SASI_Hs01_00082635 predicted 1574
13 SASI_Hs01_00082638 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147762 predicted 772
2 SASI_Hs01_00147764 predicted 1464
3 SASI_Hs01_00147765 predicted 1502
4 SASI_Hs01_00147766 predicted 1189
5 SASI_Hs01_00147767 predicted 1495
6 SASI_Hs01_00147768 predicted 899
7 SASI_Hs02_00371645 predicted 670
8 SASI_Hs01_00147769 predicted 935
9 SASI_Hs01_00147770 predicted 1465
10 SASI_Hs02_00371646 predicted 1277
11 SASI_Hs01_00147763 predicted 1110
12 SASI_Hs01_00147771 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094443 predicted 1783
2 SASI_Rn01_00094444 predicted 1948
3 SASI_Rn01_00094446 predicted 2079
4 SASI_Rn01_00094448 predicted 2191
5 SASI_Rn01_00094449 predicted 1377
6 SASI_Rn01_00094450 predicted 2265
7 SASI_Rn01_00094451 predicted 383
8 SASI_Rn02_00266112 predicted 1375
9 SASI_Rn01_00094452 predicted 1187
10 SASI_Rn02_00266113 predicted 1950
11 SASI_Rn01_00094445 predicted 1818
12 SASI_Rn01_00094447 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102715 predicted 1606
2 SASI_Mm01_00102716 predicted 1780
3 SASI_Mm01_00102717 predicted 1639
4 SASI_Mm01_00102718 predicted 1013
5 SASI_Mm01_00102719 predicted 1524
6 SASI_Mm01_00102721 predicted 1312
7 SASI_Mm02_00318892 predicted 1964
8 SASI_Mm01_00102722 predicted 219
9 SASI_Mm01_00102723 predicted 1847
10 SASI_Mm02_00318893 predicted 2004
11 SASI_Mm01_00102720 predicted 1211
12 SASI_Mm01_00102724 predicted 1464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010590
VALIDATED
AJUBA MISSION shRNA Bacterial Glycerol Stock
ajuba LIM protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010590.2-3096s1c1
Sequence:CCGGCCTGGCTTACTTCAGAGTTATCTCGAGATAACTCTGAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010590.2-1022s1c1
Sequence:CCGGGCTAACAGCATTGCTGCGTTTCTCGAGAAACGCAGCAATGCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1310s1c1
Sequence:CCGGCAAGGCTTTCTACAGCGTCAACTCGAGTTGACGCTGTAGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1405s1c1
Sequence:CCGGGCCACTTGATTCTAGAGAAGACTCGAGTCTTCTCTAGAATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1193s1c1
Sequence:CCGGCACCTGTATCAAGTGCAACAACTCGAGTTGTTGCACTTGATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010590.4-1843s21c1
Sequence:CCGGAGCGGAGGCAAGGAGTGTATTCTCGAGAATACACTCCTTGCCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-1787s21c1
Sequence:CCGGCTATATCTGAGCTGACGTTACCTCGAGGTAACGTCAGCTCAGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-488s21c1
Sequence:CCGGTCTGTCGTCGCCTCCTGATTTCTCGAGAAATCAGGAGGCGACGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010590
VALIDATED
AJUBA MISSION shRNA shRNA Plasmid DNA
ajuba LIM protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010590.2-3096s1c1
Sequence:CCGGCCTGGCTTACTTCAGAGTTATCTCGAGATAACTCTGAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010590.2-1022s1c1
Sequence:CCGGGCTAACAGCATTGCTGCGTTTCTCGAGAAACGCAGCAATGCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1310s1c1
Sequence:CCGGCAAGGCTTTCTACAGCGTCAACTCGAGTTGACGCTGTAGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1405s1c1
Sequence:CCGGGCCACTTGATTCTAGAGAAGACTCGAGTCTTCTCTAGAATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1193s1c1
Sequence:CCGGCACCTGTATCAAGTGCAACAACTCGAGTTGTTGCACTTGATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010590.4-1843s21c1
Sequence:CCGGAGCGGAGGCAAGGAGTGTATTCTCGAGAATACACTCCTTGCCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-1787s21c1
Sequence:CCGGCTATATCTGAGCTGACGTTACCTCGAGGTAACGTCAGCTCAGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-488s21c1
Sequence:CCGGTCTGTCGTCGCCTCCTGATTTCTCGAGAAATCAGGAGGCGACGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010590
VALIDATED
AJUBA MISSION shRNA Lentiviral Transduction Particles
ajuba LIM protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010590.2-3096s1c1
Sequence:CCGGCCTGGCTTACTTCAGAGTTATCTCGAGATAACTCTGAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010590.2-1022s1c1
Sequence:CCGGGCTAACAGCATTGCTGCGTTTCTCGAGAAACGCAGCAATGCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1310s1c1
Sequence:CCGGCAAGGCTTTCTACAGCGTCAACTCGAGTTGACGCTGTAGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1405s1c1
Sequence:CCGGGCCACTTGATTCTAGAGAAGACTCGAGTCTTCTCTAGAATCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010590.2-1193s1c1
Sequence:CCGGCACCTGTATCAAGTGCAACAACTCGAGTTGTTGCACTTGATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010590.4-1843s21c1
Sequence:CCGGAGCGGAGGCAAGGAGTGTATTCTCGAGAATACACTCCTTGCCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-1787s21c1
Sequence:CCGGCTATATCTGAGCTGACGTTACCTCGAGGTAACGTCAGCTCAGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010590.4-488s21c1
Sequence:CCGGTCTGTCGTCGCCTCCTGATTTCTCGAGAAATCAGGAGGCGACGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032876
VALIDATED
AJUBA MISSION shRNA Bacterial Glycerol Stock
ajuba LIM protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-1385s1c1
Sequence:CCGGACCTGTATCAAGTGCAACAAACTCGAGTTTGTTGCACTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-2786s1c1
Sequence:CCGGGCTCCTTATCTGTCTGAGAATCTCGAGATTCTCAGACAGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1527s1c1
Sequence:CCGGCTGTGTACTGTGAGGAAGATTCTCGAGAATCTTCCTCACAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1381s1c1
Sequence:CCGGCGGCACCTGTATCAAGTGCAACTCGAGTTGCACTTGATACAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-423s1c1
Sequence:CCGGGCCGCAGAAAGGGTGAATCTACTCGAGTAGATTCACCCTTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1706s21c1
Sequence:CCGGGACTTCTCCAACCAAGTATACCTCGAGGTATACTTGGTTGGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1830s21c1
Sequence:CCGGTGGACCGGGATTATCACTTTGCTCGAGCAAAGTGATAATCCCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1386s21c1
Sequence:CCGGCCTGTATCAAGTGCAACAAAGCTCGAGCTTTGTTGCACTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1587s21c1
Sequence:CCGGGTGTCTGTGGTCACTTGATTTCTCGAGAAATCAAGTGACCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032876
VALIDATED
AJUBA MISSION shRNA shRNA Plasmid DNA
ajuba LIM protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-1385s1c1
Sequence:CCGGACCTGTATCAAGTGCAACAAACTCGAGTTTGTTGCACTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-2786s1c1
Sequence:CCGGGCTCCTTATCTGTCTGAGAATCTCGAGATTCTCAGACAGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1527s1c1
Sequence:CCGGCTGTGTACTGTGAGGAAGATTCTCGAGAATCTTCCTCACAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1381s1c1
Sequence:CCGGCGGCACCTGTATCAAGTGCAACTCGAGTTGCACTTGATACAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-423s1c1
Sequence:CCGGGCCGCAGAAAGGGTGAATCTACTCGAGTAGATTCACCCTTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1706s21c1
Sequence:CCGGGACTTCTCCAACCAAGTATACCTCGAGGTATACTTGGTTGGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1830s21c1
Sequence:CCGGTGGACCGGGATTATCACTTTGCTCGAGCAAAGTGATAATCCCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1386s21c1
Sequence:CCGGCCTGTATCAAGTGCAACAAAGCTCGAGCTTTGTTGCACTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1587s21c1
Sequence:CCGGGTGTCTGTGGTCACTTGATTTCTCGAGAAATCAAGTGACCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032876
VALIDATED
AJUBA MISSION shRNA Lentiviral Transduction Particles
ajuba LIM protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-1385s1c1
Sequence:CCGGACCTGTATCAAGTGCAACAAACTCGAGTTTGTTGCACTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032876.4-2786s1c1
Sequence:CCGGGCTCCTTATCTGTCTGAGAATCTCGAGATTCTCAGACAGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1527s1c1
Sequence:CCGGCTGTGTACTGTGAGGAAGATTCTCGAGAATCTTCCTCACAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-1381s1c1
Sequence:CCGGCGGCACCTGTATCAAGTGCAACTCGAGTTGCACTTGATACAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032876.4-423s1c1
Sequence:CCGGGCCGCAGAAAGGGTGAATCTACTCGAGTAGATTCACCCTTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1706s21c1
Sequence:CCGGGACTTCTCCAACCAAGTATACCTCGAGGTATACTTGGTTGGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1830s21c1
Sequence:CCGGTGGACCGGGATTATCACTTTGCTCGAGCAAAGTGATAATCCCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1386s21c1
Sequence:CCGGCCTGTATCAAGTGCAACAAAGCTCGAGCTTTGTTGCACTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032876.4-1587s21c1
Sequence:CCGGGTGTCTGTGGTCACTTGATTTCTCGAGAAATCAAGTGACCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks