EMAIL THIS PAGE TO A FRIEND

AK1

adenylate kinase 1

82 Gene Product Result for
UniProtKB ID: P00568, Q9BVK9, Q9UQC7
Gene ID:
Human(203) Summary: Adenylate kinase is an enzyme involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate group among adinine nucleotides. Three isozymes of adenylate kinase have been identified in vertebrates, adenylate isozyme 1 (AK1), 2 (AK2) and 3 (AK3). AK1 is found in the cytosol of skeletal muscle, brain and erythrocytes, whereas AK2 and AK3 are found in the mitochondria of other tissues including liver and heart. AK1 was identified because of its association with a rare genetic disorder causing nonspherocytic hemolytic anemia where a mutation in the AK1 gene was found to reduce the catalytic activity of the enzyme. [provided by RefSeq, Jul 2008]
Mouse(11636) adenylate kinase 1
Rat(24183) adenylate kinase 1
naked mole-rat(101718797) adenylate kinase 1
domestic guinea pig(100724853) adenylate kinase 1
sheep(100302085) adenylate kinase 1
Zebrafish(445486) adenylate kinase 1
domestic cat(101093653) adenylate kinase 1
cow(280715) adenylate kinase 1
dog(480712) adenylate kinase 1
chicken(396002) adenylate kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A4107 Anti-AK1 (136-150) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
A3982 Anti-AK1 (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2100084 Anti-AK1 (ab1) antibody produced in rabbit affinity isolated antibody pig, human, horse, sheep, guinea pig, bovine, rabbit, mouse, rabbit, canine, rat
western blot pricing
SAB2100085 Anti-AK1 (ab2) antibody produced in rabbit affinity isolated antibody canine, zebrafish, sheep, pig, human, rabbit, rabbit, mouse, guinea pig, horse, bovine, rat
western blot pricing
SAB1412004 ANTI-AK1 antibody produced in mouse clone 3G8-1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412005 ANTI-AK1 antibody produced in mouse clone M2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412122 ANTI-AK1 antibody produced in mouse clone 4C2-1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA006456 Anti-AK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500769 Anti-KAD1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
WH0000203M6 Monoclonal Anti-AK1 antibody produced in mouse clone 3A6-1F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403537 Monoclonal Anti-AK1 antibody produced in mouse clone M1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000476 Rosetta Predictions human pricing
NM_024349 Rosetta Predictions rat pricing
NM_021515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124856 predicted 313
2 SASI_Hs01_00124857 predicted 841
3 SASI_Hs01_00124858 predicted 937
4 SASI_Hs02_00302614 predicted 225
5 SASI_Hs01_00124859 predicted 619
6 SASI_Hs01_00124860 predicted 719
7 SASI_Hs01_00124861 predicted 637
8 SASI_Hs01_00124862 predicted 627
9 SASI_Hs02_00302615 predicted 630
10 SASI_Hs01_00124865 predicted 600
11 SASI_Hs01_00124863 predicted 492
12 SASI_Hs01_00124864 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030210 predicted 745
2 SASI_Rn01_00030211 predicted 739
3 SASI_Rn01_00030212 predicted 591
4 SASI_Rn01_00030213 predicted 263
5 SASI_Rn02_00263901 predicted 560
6 SASI_Rn01_00030214 predicted 746
7 SASI_Rn01_00030215 predicted 372
8 SASI_Rn01_00030216 predicted 544
9 SASI_Rn01_00030217 predicted 761
10 SASI_Rn01_00030218 predicted 596
11 SASI_Rn01_00030219 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096895 predicted 575
2 SASI_Mm02_00326237 predicted 333
3 SASI_Mm01_00096896 predicted 664
4 SASI_Mm01_00096897 predicted 588
5 SASI_Mm02_00326238 predicted 418
6 SASI_Mm01_00096898 predicted 297
7 SASI_Mm01_00096899 predicted 201
8 SASI_Mm01_00096900 predicted 808
9 SASI_Mm01_00096901 predicted 844
10 SASI_Mm02_00326239 predicted 351
11 SASI_Mm01_00096902 predicted 653
12 SASI_Mm01_00096903 predicted 614
13 SASI_Mm01_00096904 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000476
VALIDATED
AK1 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-625s21c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-321s21c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-546s1c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-1966s1c1
Sequence:CCGGCACTGAGAAAGGCTCAATTTGCTCGAGCAAATTGAGCCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-494s1c1
Sequence:CCGGCGACAATGAGGAGACCATCAACTCGAGTTGATGGTCTCCTCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-158s1c1
Sequence:CCGGCGTGCAGAAGTATGGCTACACCTCGAGGTGTAGCCATACTTCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-852s1c1
Sequence:CCGGGCTTCCAGTTGGAGTTGATTCCTCGAGGAATCAACTCCAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-2069s1c1
Sequence:CCGGCCGAATGAAATCCGAACAGTTCTCGAGAACTGTTCGGATTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-242s1c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-318s1c1
Sequence:CCGGGCCAAAGTCAATACTTCCAAACTCGAGTTTGGAAGTATTGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-560s1c1
Sequence:CCGGCTTCTATGAGAAACGTGGCATCTCGAGATGCCACGTTTCTCATAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-381s1c1
Sequence:CCGGGAAGAGTTTGAGCGACGGATTCTCGAGAATCCGTCGCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000476
VALIDATED
AK1 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-625s21c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-321s21c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-546s1c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-1966s1c1
Sequence:CCGGCACTGAGAAAGGCTCAATTTGCTCGAGCAAATTGAGCCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-494s1c1
Sequence:CCGGCGACAATGAGGAGACCATCAACTCGAGTTGATGGTCTCCTCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-158s1c1
Sequence:CCGGCGTGCAGAAGTATGGCTACACCTCGAGGTGTAGCCATACTTCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-852s1c1
Sequence:CCGGGCTTCCAGTTGGAGTTGATTCCTCGAGGAATCAACTCCAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-2069s1c1
Sequence:CCGGCCGAATGAAATCCGAACAGTTCTCGAGAACTGTTCGGATTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-242s1c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-318s1c1
Sequence:CCGGGCCAAAGTCAATACTTCCAAACTCGAGTTTGGAAGTATTGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-560s1c1
Sequence:CCGGCTTCTATGAGAAACGTGGCATCTCGAGATGCCACGTTTCTCATAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-381s1c1
Sequence:CCGGGAAGAGTTTGAGCGACGGATTCTCGAGAATCCGTCGCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000476
VALIDATED
AK1 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-625s21c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000476.2-321s21c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-546s1c1
Sequence:CCGGGAACCCGTCATCGCCTTCTATCTCGAGATAGAAGGCGATGACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-1966s1c1
Sequence:CCGGCACTGAGAAAGGCTCAATTTGCTCGAGCAAATTGAGCCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-494s1c1
Sequence:CCGGCGACAATGAGGAGACCATCAACTCGAGTTGATGGTCTCCTCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-158s1c1
Sequence:CCGGCGTGCAGAAGTATGGCTACACCTCGAGGTGTAGCCATACTTCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-852s1c1
Sequence:CCGGGCTTCCAGTTGGAGTTGATTCCTCGAGGAATCAACTCCAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000476.1-2069s1c1
Sequence:CCGGCCGAATGAAATCCGAACAGTTCTCGAGAACTGTTCGGATTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-242s1c1
Sequence:CCGGGCTGTCGGAAATCATGGAGAACTCGAGTTCTCCATGATTTCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-318s1c1
Sequence:CCGGGCCAAAGTCAATACTTCCAAACTCGAGTTTGGAAGTATTGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000476.1-560s1c1
Sequence:CCGGCTTCTATGAGAAACGTGGCATCTCGAGATGCCACGTTTCTCATAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000476.1-381s1c1
Sequence:CCGGGAAGAGTTTGAGCGACGGATTCTCGAGAATCCGTCGCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021515
VALIDATED
AK1 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-672s21c1
Sequence:CCGGATCTTGACTCCCTGAAGTAACCTCGAGGTTACTTCAGGGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-811s21c1
Sequence:CCGGTCCTGTCCCATGGACACTAAACTCGAGTTTAGTGTCCATGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-550s21c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-594s21c1
Sequence:CCGGTCTATGACAAGCGTGGCATTGCTCGAGCAATGCCACGCTTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-398s21c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-335s1c1
Sequence:CCGGCGAGATGCTATGTTAGCCAAACTCGAGTTTGGCTAACATAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-118s1c1
Sequence:CCGGGCTGAAGAAGGCCAAGATCATCTCGAGATGATCTTGGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-550s1c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-560s1c1
Sequence:CCGGACTTATTACAATGCCACAGAACTCGAGTTCTGTGGCATTGTAATAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-398s1c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021515
VALIDATED
AK1 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-672s21c1
Sequence:CCGGATCTTGACTCCCTGAAGTAACCTCGAGGTTACTTCAGGGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-811s21c1
Sequence:CCGGTCCTGTCCCATGGACACTAAACTCGAGTTTAGTGTCCATGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-550s21c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-594s21c1
Sequence:CCGGTCTATGACAAGCGTGGCATTGCTCGAGCAATGCCACGCTTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-398s21c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-335s1c1
Sequence:CCGGCGAGATGCTATGTTAGCCAAACTCGAGTTTGGCTAACATAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-118s1c1
Sequence:CCGGGCTGAAGAAGGCCAAGATCATCTCGAGATGATCTTGGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-550s1c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-560s1c1
Sequence:CCGGACTTATTACAATGCCACAGAACTCGAGTTCTGTGGCATTGTAATAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-398s1c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021515
VALIDATED
AK1 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-672s21c1
Sequence:CCGGATCTTGACTCCCTGAAGTAACCTCGAGGTTACTTCAGGGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-811s21c1
Sequence:CCGGTCCTGTCCCATGGACACTAAACTCGAGTTTAGTGTCCATGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-550s21c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-594s21c1
Sequence:CCGGTCTATGACAAGCGTGGCATTGCTCGAGCAATGCCACGCTTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021515.2-398s21c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-335s1c1
Sequence:CCGGCGAGATGCTATGTTAGCCAAACTCGAGTTTGGCTAACATAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-118s1c1
Sequence:CCGGGCTGAAGAAGGCCAAGATCATCTCGAGATGATCTTGGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-550s1c1
Sequence:CCGGGCGGCTGGAGACTTATTACAACTCGAGTTGTAATAAGTCTCCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021515.1-560s1c1
Sequence:CCGGACTTATTACAATGCCACAGAACTCGAGTTCTGTGGCATTGTAATAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021515.1-398s1c1
Sequence:CCGGGAGGTGAAACAGGGAGAAGAACTCGAGTTCTTCTCCCTGTTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks