EMAIL THIS PAGE TO A FRIEND

AK2

adenylate kinase 2

200 Gene Product Result for
Synonyms: ADK2 AK 2
Gene ID:
Human(204) Summary: Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]
Mouse(11637) adenylate kinase 2
Rat(24184) adenylate kinase 2
naked mole-rat(101697619) adenylate kinase 2
domestic guinea pig(100714579) adenylate kinase 2
sheep(101110653) adenylate kinase 2
Zebrafish(321793) adenylate kinase 2
chicken(428227) adenylate kinase 2
domestic cat(101081398) adenylate kinase 2
cow(280716) adenylate kinase 2
dog(478145) adenylate kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001625 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001625 Rosetta Predictions human pricing
NM_013411 Rosetta Predictions human pricing
NM_001033967 Rosetta Predictions rat pricing
NM_030986 Rosetta Predictions rat pricing
NM_001033966 Rosetta Predictions mouse pricing
NM_016895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179650 predicted 430
2 SASI_Hs01_00179651 predicted 250
3 SASI_Hs02_00332188 predicted 433
4 SASI_Hs01_00179652 predicted 200
5 SASI_Hs01_00179653 predicted 432
6 SASI_Hs01_00179654 predicted 392
7 SASI_Hs01_00179656 predicted 360
8 SASI_Hs01_00179657 predicted 255
9 SASI_Hs01_00179658 predicted 442
10 SASI_Hs02_00332189 predicted 269
11 SASI_Hs01_00179655 predicted 242
12 SASI_Hs01_00179659 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221882 predicted 456
2 SASI_Hs01_00221883 predicted 264
3 SASI_Hs02_00344798 predicted 453
4 SASI_Hs01_00221884 predicted 223
5 SASI_Hs01_00221885 predicted 448
6 SASI_Hs01_00221886 predicted 416
7 SASI_Hs01_00221888 predicted 382
8 SASI_Hs01_00221889 predicted 273
9 SASI_Hs01_00221890 predicted 459
10 SASI_Hs02_00344799 predicted 291
11 SASI_Hs01_00221887 predicted 260
12 SASI_Hs01_00221891 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203842 predicted 596
2 SASI_Rn02_00203843 predicted 159
3 SASI_Rn02_00203844 predicted 807
4 SASI_Rn01_00118706 predicted 369
5 SASI_Rn01_00118707 predicted 304
6 SASI_Rn01_00118708 predicted 381
7 SASI_Rn01_00118709 predicted 375
8 SASI_Rn01_00118710 predicted 389
9 SASI_Rn01_00118711 predicted 282
10 SASI_Rn01_00118712 predicted 377
11 SASI_Rn01_00118713 predicted 303
12 SASI_Rn01_00118714 predicted 300
13 SASI_Rn01_00118715 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072807 predicted 817
2 SASI_Rn02_00264141 predicted 720
3 SASI_Rn02_00264142 predicted 815
4 SASI_Rn02_00264143 predicted 712
5 SASI_Rn02_00264144 predicted 809
6 SASI_Rn02_00264145 predicted 728
7 SASI_Rn02_00264146 predicted 614
8 SASI_Rn02_00264147 predicted 168
9 SASI_Rn01_00072798 predicted 383
10 SASI_Rn01_00072799 predicted 315
11 SASI_Rn01_00072800 predicted 388
12 SASI_Rn01_00072801 predicted 389
13 SASI_Rn01_00072802 predicted 395
14 SASI_Rn01_00072803 predicted 295
15 SASI_Rn01_00072804 predicted 392
16 SASI_Rn01_00072805 predicted 314
17 SASI_Rn01_00072806 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289049 predicted 274
2 SASI_Mm02_00289050 predicted 304
3 SASI_Mm01_00036057 predicted 545
4 SASI_Mm02_00289051 predicted 430
5 SASI_Mm01_00036060 predicted 544
6 SASI_Mm02_00289052 predicted 282
7 SASI_Mm02_00289053 predicted 299
8 SASI_Mm02_00289054 predicted 290
9 SASI_Mm01_00036063 predicted 544
10 SASI_Mm01_00036064 predicted 519
11 SASI_Mm01_00036058 predicted 532
12 SASI_Mm01_00036059 predicted 474
13 SASI_Mm01_00036061 predicted 522
14 SASI_Mm01_00036062 predicted 531
15 SASI_Mm01_00036065 predicted 485
16 SASI_Mm01_00036066 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323733 predicted 221
2 SASI_Mm02_00323734 predicted 248
3 SASI_Mm01_00189879 predicted 498
4 SASI_Mm02_00323735 predicted 384
5 SASI_Mm01_00189882 predicted 493
6 SASI_Mm02_00323736 predicted 240
7 SASI_Mm02_00323737 predicted 251
8 SASI_Mm02_00323738 predicted 236
9 SASI_Mm01_00189885 predicted 496
10 SASI_Mm01_00189886 predicted 477
11 SASI_Mm01_00189880 predicted 483
12 SASI_Mm01_00189881 predicted 427
13 SASI_Mm01_00189883 predicted 478
14 SASI_Mm01_00189884 predicted 482
15 SASI_Mm01_00189887 predicted 428
16 SASI_Mm01_00189888 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016895
VALIDATED
AK2 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-259s21c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-1012s21c1
Sequence:CCGGGATAAGGAGACATGGTATTATCTCGAGATAATACCATGTCTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-713s21c1
Sequence:CCGGCCAAAGCCACATCCTAGTAACCTCGAGGTTACTAGGATGTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-243s21c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016895.3-403s21c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-403s1c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-259s1c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-477s1c1
Sequence:CCGGCCGGTCCTACCATGAGGAATTCTCGAGAATTCCTCATGGTAGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-708s1c1
Sequence:CCGGCTTCTCCAAAGCCACATCCTACTCGAGTAGGATGTGGCTTTGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-243s1c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016895
VALIDATED
AK2 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-259s21c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-1012s21c1
Sequence:CCGGGATAAGGAGACATGGTATTATCTCGAGATAATACCATGTCTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-713s21c1
Sequence:CCGGCCAAAGCCACATCCTAGTAACCTCGAGGTTACTAGGATGTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-243s21c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016895.3-403s21c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-403s1c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-259s1c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-477s1c1
Sequence:CCGGCCGGTCCTACCATGAGGAATTCTCGAGAATTCCTCATGGTAGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-708s1c1
Sequence:CCGGCTTCTCCAAAGCCACATCCTACTCGAGTAGGATGTGGCTTTGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-243s1c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016895
VALIDATED
AK2 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-259s21c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-1012s21c1
Sequence:CCGGGATAAGGAGACATGGTATTATCTCGAGATAATACCATGTCTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-713s21c1
Sequence:CCGGCCAAAGCCACATCCTAGTAACCTCGAGGTTACTAGGATGTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016895.3-243s21c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016895.3-403s21c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-403s1c1
Sequence:CCGGGTCATTGAGTTCAGCATCCAACTCGAGTTGGATGCTGAACTCAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-259s1c1
Sequence:CCGGGAAATGGTTGTGGAGCTAATTCTCGAGAATTAGCTCCACAACCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-477s1c1
Sequence:CCGGCCGGTCCTACCATGAGGAATTCTCGAGAATTCCTCATGGTAGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016895.2-708s1c1
Sequence:CCGGCTTCTCCAAAGCCACATCCTACTCGAGTAGGATGTGGCTTTGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016895.2-243s1c1
Sequence:CCGGGAAACTGGTGAGTGACGAAATCTCGAGATTTCGTCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001625
VALIDATED
AK2 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-255s21c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-627s21c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-690s21c1
Sequence:CCGGCGATGTCGTGTTCGCAAGCATCTCGAGATGCTTGCGAACACGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001625.2-379s21c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-730s21c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-764s1c1
Sequence:CCGGGTTGGGTCCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGGACCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-730s1c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-379s1c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-255s1c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-525s1c1
Sequence:CCGGGCCCATGAAAGATGACATCACCTCGAGGTGATGTCATCTTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-627s1c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-803s1c1
Sequence:CCGGCAATGGGTGGGAATGATAGGACTCGAGTCCTATCATTCCCACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001625
VALIDATED
AK2 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-255s21c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-627s21c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-690s21c1
Sequence:CCGGCGATGTCGTGTTCGCAAGCATCTCGAGATGCTTGCGAACACGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001625.2-379s21c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-730s21c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-764s1c1
Sequence:CCGGGTTGGGTCCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGGACCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-730s1c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-379s1c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-255s1c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-525s1c1
Sequence:CCGGGCCCATGAAAGATGACATCACCTCGAGGTGATGTCATCTTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-627s1c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-803s1c1
Sequence:CCGGCAATGGGTGGGAATGATAGGACTCGAGTCCTATCATTCCCACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001625
VALIDATED
AK2 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-255s21c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-627s21c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-690s21c1
Sequence:CCGGCGATGTCGTGTTCGCAAGCATCTCGAGATGCTTGCGAACACGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001625.2-379s21c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001625.2-730s21c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-764s1c1
Sequence:CCGGGTTGGGTCCAAGAAGGAATTTCTCGAGAAATTCCTTCTTGGACCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-730s1c1
Sequence:CCGGGCCACATGTAAAGACTTGGTTCTCGAGAACCAAGTCTTTACATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-379s1c1
Sequence:CCGGGACCTCATGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCATGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001625.2-255s1c1
Sequence:CCGGGAAACTGGTGAGTGATGAAATCTCGAGATTTCATCACTCACCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-525s1c1
Sequence:CCGGGCCCATGAAAGATGACATCACCTCGAGGTGATGTCATCTTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-627s1c1
Sequence:CCGGCCCACTCATAGAGTACTACAGCTCGAGCTGTAGTACTCTATGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001625.2-803s1c1
Sequence:CCGGCAATGGGTGGGAATGATAGGACTCGAGTCCTATCATTCCCACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks