EMAIL THIS PAGE TO A FRIEND

AK3

adenylate kinase 3

Synonyms: AK3L1 AK6 AKL3L AKL3L1 FIX
Gene ID:
Human(50808) Summary: The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(56248) adenylate kinase 3
Rat(26956) adenylate kinase 3
Zebrafish(406404) adenylate kinase 3
Thale Cress(821287) aspartokinase 3
chicken(426534) adenylate kinase 3
dog(476342) adenylate kinase 4
cow(281613) adenylate kinase 3
domestic cat(101099336) adenylate kinase 3
sheep(101113201) adenylate kinase 3
domestic guinea pig(100723741) adenylate kinase 3
naked mole-rat(101716319) adenylate kinase 3
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016282 Rosetta Predictions human pricing
NM_013218 Rosetta Predictions rat pricing
NM_021299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349197 predicted 452
2 SASI_Hs01_00045868 predicted 639
3 SASI_Hs01_00045869 predicted 292
4 SASI_Hs02_00349198 predicted 507
5 SASI_Hs01_00045870 predicted 902
6 SASI_Hs01_00045873 predicted 737
7 SASI_Hs01_00045874 predicted 281
8 SASI_Hs01_00045875 predicted 496
9 SASI_Hs01_00045876 predicted 740
10 SASI_Hs01_00045877 predicted 288
11 SASI_Hs01_00045871 predicted 824
12 SASI_Hs01_00045872 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035745 predicted 346
2 SASI_Rn01_00035747 predicted 451
3 SASI_Rn02_00261081 predicted 309
4 SASI_Rn01_00035748 predicted 205
5 SASI_Rn01_00035749 predicted 369
6 SASI_Rn01_00035750 predicted 550
7 SASI_Rn01_00035751 predicted 416
8 SASI_Rn01_00035752 predicted 347
9 SASI_Rn01_00035753 predicted 215
10 SASI_Rn01_00035754 predicted 352
11 SASI_Rn01_00035746 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081095 predicted 850
2 SASI_Mm01_00081096 predicted 506
3 SASI_Mm01_00081097 predicted 571
4 SASI_Mm01_00081098 predicted 331
5 SASI_Mm01_00081099 predicted 376
6 SASI_Mm01_00081100 predicted 428
7 SASI_Mm01_00081101 predicted 584
8 SASI_Mm01_00081102 predicted 590
9 SASI_Mm01_00081103 predicted 203
10 SASI_Mm01_00081104 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016282
VALIDATED
AK3 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016282.2-630s1c1
Sequence:CCGGGATAAACCAGAGACGGTTATCCTCGAGGATAACCGTCTCTGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016282.2-2468s1c1
Sequence:CCGGCACTAGGTTATCAAGCATATACTCGAGTATATGCTTGATAACCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016282.2-1689s1c1
Sequence:CCGGGCCCTGATAAATAACAAGTTACTCGAGTAACTTGTTATTTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-464s1c1
Sequence:CCGGCGACACAGTGATTAACCTGAACTCGAGTTCAGGTTAATCACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-312s1c1
Sequence:CCGGGCTTTCATTGACCAAGGGAAACTCGAGTTTCCCTTGGTCAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-443s1c1
Sequence:CCGGCCTAGATAGAGCTTATCAGATCTCGAGATCTGATAAGCTCTATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-731s1c1
Sequence:CCGGCGGAACAGAAACCAACAAGATCTCGAGATCTTGTTGGTTTCTGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-641s21c1
Sequence:CCGGGACGGTTATCAAGAGACTAAACTCGAGTTTAGTCTCTTGATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-2180s21c1
Sequence:CCGGGCCGTCTTACAAGTCGTTATTCTCGAGAATAACGACTTGTAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-615s21c1
Sequence:CCGGATTCAGCGTGAGGATGATAAACTCGAGTTTATCATCCTCACGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-541s21c1
Sequence:CCGGGTGGCCGAGTCTATAACATTGCTCGAGCAATGTTATAGACTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-459s21c1
Sequence:CCGGCAGATCGACACAGTGATTAACCTCGAGGTTAATCACTGTGTCGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-485s21c1
Sequence:CCGGTGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-1054s21c1
Sequence:CCGGCAGCGATGTCTGAACCTTTAACTCGAGTTAAAGGTTCAGACATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-765s21c1
Sequence:CCGGTATGCTTTCCTACAAACTAAACTCGAGTTTAGTTTGTAGGAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016282
VALIDATED
AK3 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016282.2-630s1c1
Sequence:CCGGGATAAACCAGAGACGGTTATCCTCGAGGATAACCGTCTCTGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016282.2-2468s1c1
Sequence:CCGGCACTAGGTTATCAAGCATATACTCGAGTATATGCTTGATAACCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016282.2-1689s1c1
Sequence:CCGGGCCCTGATAAATAACAAGTTACTCGAGTAACTTGTTATTTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-464s1c1
Sequence:CCGGCGACACAGTGATTAACCTGAACTCGAGTTCAGGTTAATCACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-312s1c1
Sequence:CCGGGCTTTCATTGACCAAGGGAAACTCGAGTTTCCCTTGGTCAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-443s1c1
Sequence:CCGGCCTAGATAGAGCTTATCAGATCTCGAGATCTGATAAGCTCTATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-731s1c1
Sequence:CCGGCGGAACAGAAACCAACAAGATCTCGAGATCTTGTTGGTTTCTGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-641s21c1
Sequence:CCGGGACGGTTATCAAGAGACTAAACTCGAGTTTAGTCTCTTGATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-2180s21c1
Sequence:CCGGGCCGTCTTACAAGTCGTTATTCTCGAGAATAACGACTTGTAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-615s21c1
Sequence:CCGGATTCAGCGTGAGGATGATAAACTCGAGTTTATCATCCTCACGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-541s21c1
Sequence:CCGGGTGGCCGAGTCTATAACATTGCTCGAGCAATGTTATAGACTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-459s21c1
Sequence:CCGGCAGATCGACACAGTGATTAACCTCGAGGTTAATCACTGTGTCGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-485s21c1
Sequence:CCGGTGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-1054s21c1
Sequence:CCGGCAGCGATGTCTGAACCTTTAACTCGAGTTAAAGGTTCAGACATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-765s21c1
Sequence:CCGGTATGCTTTCCTACAAACTAAACTCGAGTTTAGTTTGTAGGAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016282
VALIDATED
AK3 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016282.2-630s1c1
Sequence:CCGGGATAAACCAGAGACGGTTATCCTCGAGGATAACCGTCTCTGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016282.2-2468s1c1
Sequence:CCGGCACTAGGTTATCAAGCATATACTCGAGTATATGCTTGATAACCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016282.2-1689s1c1
Sequence:CCGGGCCCTGATAAATAACAAGTTACTCGAGTAACTTGTTATTTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-464s1c1
Sequence:CCGGCGACACAGTGATTAACCTGAACTCGAGTTCAGGTTAATCACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-312s1c1
Sequence:CCGGGCTTTCATTGACCAAGGGAAACTCGAGTTTCCCTTGGTCAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-443s1c1
Sequence:CCGGCCTAGATAGAGCTTATCAGATCTCGAGATCTGATAAGCTCTATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016282.2-731s1c1
Sequence:CCGGCGGAACAGAAACCAACAAGATCTCGAGATCTTGTTGGTTTCTGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-641s21c1
Sequence:CCGGGACGGTTATCAAGAGACTAAACTCGAGTTTAGTCTCTTGATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-2180s21c1
Sequence:CCGGGCCGTCTTACAAGTCGTTATTCTCGAGAATAACGACTTGTAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-615s21c1
Sequence:CCGGATTCAGCGTGAGGATGATAAACTCGAGTTTATCATCCTCACGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-541s21c1
Sequence:CCGGGTGGCCGAGTCTATAACATTGCTCGAGCAATGTTATAGACTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-459s21c1
Sequence:CCGGCAGATCGACACAGTGATTAACCTCGAGGTTAATCACTGTGTCGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-485s21c1
Sequence:CCGGTGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-1054s21c1
Sequence:CCGGCAGCGATGTCTGAACCTTTAACTCGAGTTAAAGGTTCAGACATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016282.2-765s21c1
Sequence:CCGGTATGCTTTCCTACAAACTAAACTCGAGTTTAGTTTGTAGGAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021299
AK3 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-239s1c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-418s1c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-711s1c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-376s1c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-145s1c1
Sequence:CCGGGTCACGCATCACCAAACACTTCTCGAGAAGTGTTTGGTGATGCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-711s21c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-376s21c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-239s21c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-418s21c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021299
AK3 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-239s1c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-418s1c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-711s1c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-376s1c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-145s1c1
Sequence:CCGGGTCACGCATCACCAAACACTTCTCGAGAAGTGTTTGGTGATGCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-711s21c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-376s21c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-239s21c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-418s21c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021299
AK3 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-239s1c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-418s1c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-711s1c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-376s1c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021299.1-145s1c1
Sequence:CCGGGTCACGCATCACCAAACACTTCTCGAGAAGTGTTTGGTGATGCGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-711s21c1
Sequence:CCGGAGACGAAAGTTCCAGAAACTACTCGAGTAGTTTCTGGAACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-376s21c1
Sequence:CCGGCCTGGATAAAGTTTATCAGATCTCGAGATCTGATAAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-239s21c1
Sequence:CCGGGCCAAGACTTTCATTGACCAACTCGAGTTGGTCAATGAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021299.1-418s21c1
Sequence:CCGGCGTGCCCTTTGAGGTCATTAACTCGAGTTAATGACCTCAAAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks