EMAIL THIS PAGE TO A FRIEND

AK4

adenylate kinase 4

Synonyms: AK 4 AK3 AK3L1 AK3L2
UniProtKB ID: P27144, B2R927, D3DQ62, Q6IBH4, Q6NXQ5, Q8IUU9
Gene ID:
Human(205) Summary: This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(11639) adenylate kinase 4
Rat(29223) adenylate kinase 4
Zebrafish(406590) adenylate kinase 4
chicken(424697) adenylate kinase 4
dog(489554) adenylate kinase 4
cow(517063) adenylate kinase 4
domestic cat(101084638) adenylate kinase 4
naked mole-rat(101709339) adenylate kinase 4
domestic guinea pig(100725972) adenylate kinase 4
sheep(101103031) adenylate kinase 4
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005353 Rosetta Predictions human pricing
NM_013410 Rosetta Predictions human pricing
NM_203464 Rosetta Predictions human pricing
NM_017135 Rosetta Predictions rat pricing
NM_009647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304855 predicted 1052
2 SASI_Hs01_00141084 predicted 765
3 SASI_Hs01_00141085 predicted 674
4 SASI_Hs02_00304856 predicted 1043
5 SASI_Hs02_00304857 predicted 894
6 SASI_Hs02_00304858 predicted 981
7 SASI_Hs02_00304859 predicted 557
8 SASI_Hs01_00141087 predicted 778
9 SASI_Hs02_00304860 predicted 686
10 SASI_Hs02_00304861 predicted 879
11 SASI_Hs01_00141081 predicted 812
12 SASI_Hs01_00141082 predicted 749
13 SASI_Hs01_00141083 predicted 679
14 SASI_Hs01_00141086 predicted 727
15 SASI_Hs01_00141088 predicted 574
16 SASI_Hs01_00141089 predicted 779
17 SASI_Hs01_00141090 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344791 predicted 894
2 SASI_Hs01_00164447 predicted 615
3 SASI_Hs01_00164448 predicted 516
4 SASI_Hs02_00344792 predicted 891
5 SASI_Hs02_00344793 predicted 744
6 SASI_Hs02_00344794 predicted 833
7 SASI_Hs02_00344795 predicted 400
8 SASI_Hs01_00164450 predicted 632
9 SASI_Hs02_00344796 predicted 530
10 SASI_Hs02_00344797 predicted 723
11 SASI_Hs01_00164444 predicted 650
12 SASI_Hs01_00164445 predicted 597
13 SASI_Hs01_00164446 predicted 532
14 SASI_Hs01_00164449 predicted 572
15 SASI_Hs01_00164451 predicted 419
16 SASI_Hs01_00164452 predicted 633
17 SASI_Hs01_00164453 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373393 predicted 938
2 SASI_Hs01_00148998 predicted 660
3 SASI_Hs01_00148999 predicted 559
4 SASI_Hs02_00373394 predicted 933
5 SASI_Hs02_00373395 predicted 782
6 SASI_Hs02_00373396 predicted 877
7 SASI_Hs02_00373397 predicted 445
8 SASI_Hs01_00149001 predicted 674
9 SASI_Hs02_00373398 predicted 570
10 SASI_Hs02_00373399 predicted 768
11 SASI_Hs01_00148995 predicted 695
12 SASI_Hs01_00148996 predicted 641
13 SASI_Hs01_00148997 predicted 568
14 SASI_Hs01_00149000 predicted 611
15 SASI_Hs01_00149002 predicted 455
16 SASI_Hs01_00149003 predicted 671
17 SASI_Hs01_00149004 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051771 predicted 201
2 SASI_Rn02_00261375 predicted 383
3 SASI_Rn01_00051772 predicted 308
4 SASI_Rn02_00261376 predicted 318
5 SASI_Rn02_00261377 predicted 393
6 SASI_Rn02_00261378 predicted 307
7 SASI_Rn02_00261379 predicted 209
8 SASI_Rn01_00051778 predicted 330
9 SASI_Rn02_00261380 predicted 323
10 SASI_Rn02_00261381 predicted 247
11 SASI_Rn01_00051770 predicted 651
12 SASI_Rn01_00051773 predicted 566
13 SASI_Rn01_00051774 predicted 310
14 SASI_Rn01_00051775 predicted 660
15 SASI_Rn01_00051776 predicted 801
16 SASI_Rn01_00051777 predicted 954
17 SASI_Rn01_00051779 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145776 predicted 652
2 SASI_Mm01_00145777 predicted 379
3 SASI_Mm01_00145778 predicted 449
4 SASI_Mm01_00145779 predicted 447
5 SASI_Mm01_00145780 predicted 819
6 SASI_Mm01_00145781 predicted 367
7 SASI_Mm02_00316632 predicted 689
8 SASI_Mm01_00145782 predicted 654
9 SASI_Mm01_00145784 predicted 204
10 SASI_Mm01_00145785 predicted 659
11 SASI_Mm01_00145783 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009647
VALIDATED
AK4 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009647.4-453s21c1
Sequence:CCGGTCTAGCGGGAGGGTCTATAACCTCGAGGTTATAGACCCTCCCGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-949s21c1
Sequence:CCGGCCCTTCACAGGAACGAGTATACTCGAGTATACTCGTTCCTGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-705s21c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-260s21c1
Sequence:CCGGTCACGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-371s21c1
Sequence:CCGGCTGTGATGTGGACCTAGTAATCTCGAGATTACTAGGTCCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-331s1c1
Sequence:CCGGGCACTGGCTGTTAGATGGATTCTCGAGAATCCATCTAACAGCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-225s1c1
Sequence:CCGGCGGAAGTTGGTGACGTGGCAACTCGAGTTGCCACGTCACCAACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-725s1c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009647.1-290s1c1
Sequence:CCGGACACGCCTAATGATGTCAGAACTCGAGTTCTGACATCATTAGGCGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009647
VALIDATED
AK4 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009647.4-453s21c1
Sequence:CCGGTCTAGCGGGAGGGTCTATAACCTCGAGGTTATAGACCCTCCCGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-949s21c1
Sequence:CCGGCCCTTCACAGGAACGAGTATACTCGAGTATACTCGTTCCTGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-705s21c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-260s21c1
Sequence:CCGGTCACGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-371s21c1
Sequence:CCGGCTGTGATGTGGACCTAGTAATCTCGAGATTACTAGGTCCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-331s1c1
Sequence:CCGGGCACTGGCTGTTAGATGGATTCTCGAGAATCCATCTAACAGCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-225s1c1
Sequence:CCGGCGGAAGTTGGTGACGTGGCAACTCGAGTTGCCACGTCACCAACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-725s1c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009647.1-290s1c1
Sequence:CCGGACACGCCTAATGATGTCAGAACTCGAGTTCTGACATCATTAGGCGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009647
VALIDATED
AK4 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009647.4-453s21c1
Sequence:CCGGTCTAGCGGGAGGGTCTATAACCTCGAGGTTATAGACCCTCCCGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-949s21c1
Sequence:CCGGCCCTTCACAGGAACGAGTATACTCGAGTATACTCGTTCCTGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-705s21c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-260s21c1
Sequence:CCGGTCACGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009647.4-371s21c1
Sequence:CCGGCTGTGATGTGGACCTAGTAATCTCGAGATTACTAGGTCCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-331s1c1
Sequence:CCGGGCACTGGCTGTTAGATGGATTCTCGAGAATCCATCTAACAGCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-225s1c1
Sequence:CCGGCGGAAGTTGGTGACGTGGCAACTCGAGTTGCCACGTCACCAACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009647.1-725s1c1
Sequence:CCGGACACCTATTCAATCCAAAGAACTCGAGTTCTTTGGATTGAATAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009647.1-290s1c1
Sequence:CCGGACACGCCTAATGATGTCAGAACTCGAGTTCTGACATCATTAGGCGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013410
VALIDATED
AK4 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-688s1c1
Sequence:CCGGGCCAGGCTAAGACAGTACAAACTCGAGTTTGTACTGTCTTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-607s1c1
Sequence:CCGGCCACCTCATGTACATGGTATTCTCGAGAATACCATGTACATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-343s1c1
Sequence:CCGGGCAAAGCAGTATATAGAGAAACTCGAGTTTCTCTATATACTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-381s1c1
Sequence:CCGGCCATGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-720s1c1
Sequence:CCGGGCCAGTCATTGAATTATACAACTCGAGTTGTATAATTCAATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-767s1c1
Sequence:CCGGCGAGGAGTGCTCCACCAATTTCTCGAGAAATTGGTGGAGCACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-280s1c1
Sequence:CCGGCGCCCAGAACTTTGGTCTCCACTCGAGTGGAGACCAAAGTTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-416s1c1
Sequence:CCGGCGCCTAATGATGTCCGAGTTGCTCGAGCAACTCGGACATCATTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-554s1c1
Sequence:CCGGGAAACACTTAAAGATCGTCTCCTCGAGGAGACGATCTTTAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1779s1c1
Sequence:CCGGGCATGGGAAGTTAAGTATTTACTCGAGTAAATACTTAACTTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-313s1c1
Sequence:CCGGCGGCCACTTCTTGCGGGAGAACTCGAGTTCTCCCGCAAGAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-345s1c1
Sequence:CCGGGCACCGAAGTTGGTGAGATGGCTCGAGCCATCTCACCAACTTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1185s1c1
Sequence:CCGGGCTGTTGCTGTGGTAATATTTCTCGAGAAATATTACCACAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013410
VALIDATED
AK4 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-688s1c1
Sequence:CCGGGCCAGGCTAAGACAGTACAAACTCGAGTTTGTACTGTCTTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-607s1c1
Sequence:CCGGCCACCTCATGTACATGGTATTCTCGAGAATACCATGTACATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-343s1c1
Sequence:CCGGGCAAAGCAGTATATAGAGAAACTCGAGTTTCTCTATATACTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-381s1c1
Sequence:CCGGCCATGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-720s1c1
Sequence:CCGGGCCAGTCATTGAATTATACAACTCGAGTTGTATAATTCAATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-767s1c1
Sequence:CCGGCGAGGAGTGCTCCACCAATTTCTCGAGAAATTGGTGGAGCACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-280s1c1
Sequence:CCGGCGCCCAGAACTTTGGTCTCCACTCGAGTGGAGACCAAAGTTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-416s1c1
Sequence:CCGGCGCCTAATGATGTCCGAGTTGCTCGAGCAACTCGGACATCATTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-554s1c1
Sequence:CCGGGAAACACTTAAAGATCGTCTCCTCGAGGAGACGATCTTTAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1779s1c1
Sequence:CCGGGCATGGGAAGTTAAGTATTTACTCGAGTAAATACTTAACTTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-313s1c1
Sequence:CCGGCGGCCACTTCTTGCGGGAGAACTCGAGTTCTCCCGCAAGAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-345s1c1
Sequence:CCGGGCACCGAAGTTGGTGAGATGGCTCGAGCCATCTCACCAACTTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1185s1c1
Sequence:CCGGGCTGTTGCTGTGGTAATATTTCTCGAGAAATATTACCACAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013410
VALIDATED
AK4 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-688s1c1
Sequence:CCGGGCCAGGCTAAGACAGTACAAACTCGAGTTTGTACTGTCTTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-607s1c1
Sequence:CCGGCCACCTCATGTACATGGTATTCTCGAGAATACCATGTACATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-343s1c1
Sequence:CCGGGCAAAGCAGTATATAGAGAAACTCGAGTTTCTCTATATACTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-381s1c1
Sequence:CCGGCCATGTGATCACACGCCTAATCTCGAGATTAGGCGTGTGATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.1-720s1c1
Sequence:CCGGGCCAGTCATTGAATTATACAACTCGAGTTGTATAATTCAATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-767s1c1
Sequence:CCGGCGAGGAGTGCTCCACCAATTTCTCGAGAAATTGGTGGAGCACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-280s1c1
Sequence:CCGGCGCCCAGAACTTTGGTCTCCACTCGAGTGGAGACCAAAGTTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-416s1c1
Sequence:CCGGCGCCTAATGATGTCCGAGTTGCTCGAGCAACTCGGACATCATTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-554s1c1
Sequence:CCGGGAAACACTTAAAGATCGTCTCCTCGAGGAGACGATCTTTAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1779s1c1
Sequence:CCGGGCATGGGAAGTTAAGTATTTACTCGAGTAAATACTTAACTTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-313s1c1
Sequence:CCGGCGGCCACTTCTTGCGGGAGAACTCGAGTTCTCCCGCAAGAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013410.2-345s1c1
Sequence:CCGGGCACCGAAGTTGGTGAGATGGCTCGAGCCATCTCACCAACTTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013410.2-1185s1c1
Sequence:CCGGGCTGTTGCTGTGGTAATATTTCTCGAGAAATATTACCACAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks