EMAIL THIS PAGE TO A FRIEND

AK4P3

adenylate kinase 4 pseudogene 3

34 Gene Product Result for
Synonyms: AK3L2 AK3L2P
Species: Human AK4P3(645619)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001132080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001132080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001132080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132080 Rosetta Predictions human pricing
XM_001725174 Rosetta Predictions human pricing
XM_928632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389014 predicted 831
2 SASI_Hs02_00389015 predicted 556
3 SASI_Hs02_00389016 predicted 463
4 SASI_Hs02_00389017 predicted 834
5 SASI_Hs02_00389018 predicted 677
6 SASI_Hs02_00389019 predicted 767
7 SASI_Hs02_00389020 predicted 663
8 SASI_Hs02_00389021 predicted 346
9 SASI_Hs02_00389022 predicted 564
10 SASI_Hs02_00389023 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466045 predicted 975
2 SASI_Hs02_00466046 predicted 704
3 SASI_Hs02_00466047 predicted 602
4 SASI_Hs02_00466048 predicted 973
5 SASI_Hs02_00466049 predicted 821
6 SASI_Hs02_00466050 predicted 912
7 SASI_Hs02_00466051 predicted 489
8 SASI_Hs02_00466052 predicted 713
9 SASI_Hs02_00466053 predicted 613
10 SASI_Hs02_00466054 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289156 predicted 980
2 SASI_Hs01_00289158 predicted 701
3 SASI_Hs02_00480897 predicted 601
4 SASI_Hs02_00480898 predicted 826
5 SASI_Hs01_00289160 predicted 918
6 SASI_Hs01_00289161 predicted 1152
7 SASI_Hs02_00480899 predicted 802
8 SASI_Hs01_00289162 predicted 487
9 SASI_Hs01_00289163 predicted 707
10 SASI_Hs02_00480900 predicted 495
11 SASI_Hs01_00289157 predicted 825
12 SASI_Hs01_00289159 predicted 602
13 SASI_Hs01_00289164 predicted 983
14 SASI_Hs01_00289165 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001132080
AK4P3 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 4 pseudogene 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2638s21c1
Sequence:CCGGTCTGAGCACTTTAGAATTTAGCTCGAGCTAAATTCTAAAGTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2506s21c1
Sequence:GTACCGGGGCTACCTTAGTGGAAATATACTCGAGTATATTTCCACTAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2613s21c1
Sequence:GTACCGGTGAATCGTCAGTGCATTATATCTCGAGATATAATGCACTGACGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2817s21c1
Sequence:CCGGTAGGAAATGTAGAGAGTTATTCTCGAGAATAACTCTCTACATTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2384s21c1
Sequence:CCGGCCAGTGAATCCTCTGTCAATTCTCGAGAATTGACAGAGGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001132080
AK4P3 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 4 pseudogene 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2638s21c1
Sequence:CCGGTCTGAGCACTTTAGAATTTAGCTCGAGCTAAATTCTAAAGTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2506s21c1
Sequence:GTACCGGGGCTACCTTAGTGGAAATATACTCGAGTATATTTCCACTAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2613s21c1
Sequence:GTACCGGTGAATCGTCAGTGCATTATATCTCGAGATATAATGCACTGACGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2817s21c1
Sequence:CCGGTAGGAAATGTAGAGAGTTATTCTCGAGAATAACTCTCTACATTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2384s21c1
Sequence:CCGGCCAGTGAATCCTCTGTCAATTCTCGAGAATTGACAGAGGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001132080
AK4P3 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 4 pseudogene 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2638s21c1
Sequence:CCGGTCTGAGCACTTTAGAATTTAGCTCGAGCTAAATTCTAAAGTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2506s21c1
Sequence:GTACCGGGGCTACCTTAGTGGAAATATACTCGAGTATATTTCCACTAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2613s21c1
Sequence:GTACCGGTGAATCGTCAGTGCATTATATCTCGAGATATAATGCACTGACGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2817s21c1
Sequence:CCGGTAGGAAATGTAGAGAGTTATTCTCGAGAATAACTCTCTACATTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001132080.2-2384s21c1
Sequence:CCGGCCAGTGAATCCTCTGTCAATTCTCGAGAATTGACAGAGGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks