EMAIL THIS PAGE TO A FRIEND

AK5

adenylate kinase 5

Synonyms: AK6
Gene ID:
Human(26289) Summary: This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(229949) adenylate kinase 5
Rat(301115) adenylate kinase 5
Zebrafish(336312) adenylate kinase 5
cow(613448) adenylate kinase 5
domestic cat(101092038) adenylate kinase 5
chicken(424555) adenylate kinase 5
dog(490204) adenylate kinase 5
sheep(101121984) adenylate kinase 5
domestic guinea pig(100714720) adenylate kinase 5
naked mole-rat(101706938) adenylate kinase 5
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012093 Rosetta Predictions human pricing
NM_174858 Rosetta Predictions human pricing
XM_001059797 Rosetta Predictions rat pricing
XM_236788 Rosetta Predictions rat pricing
NM_001081277 Rosetta Predictions mouse pricing
XM_884305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025306 predicted 1573
2 SASI_Hs01_00025307 predicted 1411
3 SASI_Hs01_00025308 predicted 1486
4 SASI_Hs01_00025309 predicted 2601
5 SASI_Hs01_00025310 predicted 1787
6 SASI_Hs01_00025311 predicted 1256
7 SASI_Hs01_00025312 predicted 1666
8 SASI_Hs01_00025314 predicted 2195
9 SASI_Hs02_00343594 predicted 1889
10 SASI_Hs02_00343595 predicted 1766
11 SASI_Hs01_00025305 predicted 2148
12 SASI_Hs01_00025313 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082225 predicted 885
2 SASI_Hs01_00082226 predicted 715
3 SASI_Hs01_00082227 predicted 800
4 SASI_Hs01_00082228 predicted 1908
5 SASI_Hs01_00082229 predicted 1092
6 SASI_Hs01_00082230 predicted 570
7 SASI_Hs01_00082231 predicted 971
8 SASI_Hs01_00082233 predicted 1511
9 SASI_Hs02_00368744 predicted 1201
10 SASI_Hs02_00368745 predicted 1070
11 SASI_Hs01_00082224 predicted 1463
12 SASI_Hs01_00082232 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294369 predicted 199
2 SASI_Rn02_00294370 predicted 215
3 SASI_Rn02_00294371 predicted 501
4 SASI_Rn02_00294372 predicted 426
5 SASI_Rn02_00294373 predicted 264
6 SASI_Rn02_00294374 predicted 213
7 SASI_Rn02_00294375 predicted 409
8 SASI_Rn02_00294376 predicted 430
9 SASI_Rn02_00294377 predicted 495
10 SASI_Rn02_00294378 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390440 predicted 236
2 SASI_Rn02_00390441 predicted 286
3 SASI_Rn02_00390442 predicted 455
4 SASI_Rn02_00390443 predicted 285
5 SASI_Rn02_00390444 predicted 430
6 SASI_Rn02_00390445 predicted 238
7 SASI_Rn02_00390446 predicted 236
8 SASI_Rn02_00390447 predicted 296
9 SASI_Rn02_00390448 predicted 203
10 SASI_Rn02_00390449 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296897 predicted 1342
2 SASI_Mm02_00296898 predicted 1390
3 SASI_Mm02_00296899 predicted 1714
4 SASI_Mm02_00296900 predicted 1295
5 SASI_Mm02_00296901 predicted 2004
6 SASI_Mm02_00296902 predicted 1545
7 SASI_Mm02_00296903 predicted 657
8 SASI_Mm02_00296904 predicted 377
9 SASI_Mm02_00296905 predicted 504
10 SASI_Mm02_00296906 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259428 predicted 1343
2 SASI_Mm01_00259429 predicted 875
3 SASI_Mm01_00259430 predicted 1397
4 SASI_Mm01_00259431 predicted 1719
5 SASI_Mm01_00259432 predicted 1300
6 SASI_Mm01_00259433 predicted 2005
7 SASI_Mm01_00259434 predicted 666
8 SASI_Mm01_00259435 predicted 388
9 SASI_Mm01_00259436 predicted 514
10 SASI_Mm01_00259437 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012093
VALIDATED
AK5 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 5
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-2004s21c1
Sequence:GTACCGGTCAGGGTGATGACCAGTTAAACTCGAGTTTAACTGGTCATCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1887s21c1
Sequence:CCGGGGCAGTTGACAACAAGTTATTCTCGAGAATAACTTGTTGTCAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1411s21c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012093.2-2612s21c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1941s21c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3386s1c1
Sequence:CCGGGTGATGCATTTCAGCAATTATCTCGAGATAATTGCTGAAATGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3440s1c1
Sequence:CCGGGCATGAGATATTTGCTATTTCCTCGAGGAAATAGCAAATATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1589s1c1
Sequence:CCGGGCATTGTTATTGATGGATTTCCTCGAGGAAATCCATCAATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1104s1c1
Sequence:CCGGCAAGGTGAAATGGGATACATTCTCGAGAATGTATCCCATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012093.2-1174s1c1
Sequence:CCGGCGGAGATCCTTTCTAAGAAATCTCGAGATTTCTTAGAAAGGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3706s1c1
Sequence:CCGGGTGCTATCAATCAGTTGTAAACTCGAGTTTACAACTGATTGATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1941s1c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3001s1c1
Sequence:CCGGCCTCTCATTAAGCATCCCTAACTCGAGTTAGGGATGCTTAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1411s1c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1246s1c1
Sequence:CCGGCCAATCCATCAATTCTCCATACTCGAGTATGGAGAATTGATGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012093.2-2612s1c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012093
VALIDATED
AK5 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 5
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-2004s21c1
Sequence:GTACCGGTCAGGGTGATGACCAGTTAAACTCGAGTTTAACTGGTCATCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1887s21c1
Sequence:CCGGGGCAGTTGACAACAAGTTATTCTCGAGAATAACTTGTTGTCAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1411s21c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012093.2-2612s21c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1941s21c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3386s1c1
Sequence:CCGGGTGATGCATTTCAGCAATTATCTCGAGATAATTGCTGAAATGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3440s1c1
Sequence:CCGGGCATGAGATATTTGCTATTTCCTCGAGGAAATAGCAAATATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1589s1c1
Sequence:CCGGGCATTGTTATTGATGGATTTCCTCGAGGAAATCCATCAATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1104s1c1
Sequence:CCGGCAAGGTGAAATGGGATACATTCTCGAGAATGTATCCCATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012093.2-1174s1c1
Sequence:CCGGCGGAGATCCTTTCTAAGAAATCTCGAGATTTCTTAGAAAGGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3706s1c1
Sequence:CCGGGTGCTATCAATCAGTTGTAAACTCGAGTTTACAACTGATTGATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1941s1c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3001s1c1
Sequence:CCGGCCTCTCATTAAGCATCCCTAACTCGAGTTAGGGATGCTTAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1411s1c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1246s1c1
Sequence:CCGGCCAATCCATCAATTCTCCATACTCGAGTATGGAGAATTGATGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012093.2-2612s1c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012093
VALIDATED
AK5 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 5
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-2004s21c1
Sequence:GTACCGGTCAGGGTGATGACCAGTTAAACTCGAGTTTAACTGGTCATCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1887s21c1
Sequence:CCGGGGCAGTTGACAACAAGTTATTCTCGAGAATAACTTGTTGTCAACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1411s21c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012093.2-2612s21c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012093.2-1941s21c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3386s1c1
Sequence:CCGGGTGATGCATTTCAGCAATTATCTCGAGATAATTGCTGAAATGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3440s1c1
Sequence:CCGGGCATGAGATATTTGCTATTTCCTCGAGGAAATAGCAAATATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1589s1c1
Sequence:CCGGGCATTGTTATTGATGGATTTCCTCGAGGAAATCCATCAATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1104s1c1
Sequence:CCGGCAAGGTGAAATGGGATACATTCTCGAGAATGTATCCCATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012093.2-1174s1c1
Sequence:CCGGCGGAGATCCTTTCTAAGAAATCTCGAGATTTCTTAGAAAGGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3706s1c1
Sequence:CCGGGTGCTATCAATCAGTTGTAAACTCGAGTTTACAACTGATTGATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1941s1c1
Sequence:CCGGCCTTGATCCTTCGATGATATTCTCGAGAATATCATCGAAGGATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012093.2-3001s1c1
Sequence:CCGGCCTCTCATTAAGCATCCCTAACTCGAGTTAGGGATGCTTAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1411s1c1
Sequence:CCGGCGATATGGATTCCAATACATTCTCGAGAATGTATTGGAATCCATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012093.2-1246s1c1
Sequence:CCGGCCAATCCATCAATTCTCCATACTCGAGTATGGAGAATTGATGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012093.2-2612s1c1
Sequence:CCGGGCACAGCTATTGACTCTATTTCTCGAGAAATAGAGTCAATAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081277
VALIDATED
AK5 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1528s21c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1338s21c1
Sequence:CCGGCAGGACGATGATCAGCTAAATCTCGAGATTTAGCTGATCATCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1808s21c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081277.1-2253s21c1
Sequence:CCGGGGGACAGCATATCCCTATTTCCTCGAGGAAATAGGGATATGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1547s21c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081277
VALIDATED
AK5 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1528s21c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1338s21c1
Sequence:CCGGCAGGACGATGATCAGCTAAATCTCGAGATTTAGCTGATCATCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1808s21c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081277.1-2253s21c1
Sequence:CCGGGGGACAGCATATCCCTATTTCCTCGAGGAAATAGGGATATGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1547s21c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081277
VALIDATED
AK5 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1528s21c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1338s21c1
Sequence:CCGGCAGGACGATGATCAGCTAAATCTCGAGATTTAGCTGATCATCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081277.1-1808s21c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081277.1-2253s21c1
Sequence:CCGGGGGACAGCATATCCCTATTTCCTCGAGGAAATAGGGATATGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081277.1-1547s21c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153066
VALIDATED
AK5 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-367s1c1
Sequence:CCGGACCATGACTAACCGCCTTCTTCTCGAGAAGAAGGCGGTTAGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-420s1c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-140s1c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-246s1c1
Sequence:CCGGCCTGGGCAACACCAAGGGCTTCTCGAGAAGCCCTTGGTGTTGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-159s1c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153066
VALIDATED
AK5 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-367s1c1
Sequence:CCGGACCATGACTAACCGCCTTCTTCTCGAGAAGAAGGCGGTTAGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-420s1c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-140s1c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-246s1c1
Sequence:CCGGCCTGGGCAACACCAAGGGCTTCTCGAGAAGCCCTTGGTGTTGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-159s1c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153066
VALIDATED
AK5 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-367s1c1
Sequence:CCGGACCATGACTAACCGCCTTCTTCTCGAGAAGAAGGCGGTTAGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-420s1c1
Sequence:CCGGCGGTGCCAAGAGCATTGCCAACTCGAGTTGGCAATGCTCTTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-140s1c1
Sequence:CCGGCCTCAGAGTCAGAAAGAAGCACTCGAGTGCTTCTTTCTGACTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153066.1-246s1c1
Sequence:CCGGCCTGGGCAACACCAAGGGCTTCTCGAGAAGCCCTTGGTGTTGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153066.1-159s1c1
Sequence:CCGGCAAACTGATCCGTGACATCATCTCGAGATGATGTCACGGATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks