EMAIL THIS PAGE TO A FRIEND

AK7

adenylate kinase 7

77 Gene Product Result for
Synonyms: AK 7
UniProtKB ID: Q96M32, Q8IYP6
Gene ID:
Mouse(78801) adenylate kinase 7
Rat(314416) adenylate kinase 7
chicken(428907) adenylate kinase 7
dog(480429) adenylate kinase 7
Horse(100054566) adenylate kinase 7
cow(511269) adenylate kinase 7
domestic cat(101091207) adenylate kinase 7
naked mole-rat(101715028) adenylate kinase 7
domestic guinea pig(100727823) adenylate kinase 7
sheep(101121552) adenylate kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152327 Rosetta Predictions human pricing
NM_001108055 Rosetta Predictions rat pricing
XM_911194 Rosetta Predictions mouse pricing
XM_994344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059346 predicted 1717
2 SASI_Hs02_00365922 predicted 827
3 SASI_Hs01_00059347 predicted 798
4 SASI_Hs01_00059348 predicted 1860
5 SASI_Hs01_00059349 predicted 779
6 SASI_Hs01_00059350 predicted 1813
7 SASI_Hs01_00059351 predicted 743
8 SASI_Hs01_00059353 predicted 1018
9 SASI_Hs01_00059354 predicted 561
10 SASI_Hs01_00059355 predicted 2083
11 SASI_Hs01_00059352 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234905 predicted 1609
2 SASI_Rn02_00234906 predicted 1165
3 SASI_Rn02_00234907 predicted 647
4 SASI_Rn02_00234908 predicted 1222
5 SASI_Rn02_00234909 predicted 1566
6 SASI_Rn02_00234910 predicted 853
7 SASI_Rn02_00234911 predicted 1260
8 SASI_Rn02_00234912 predicted 991
9 SASI_Rn02_00234913 predicted 1578
10 SASI_Rn02_00234914 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436264 predicted 1790
2 SASI_Mm02_00436265 predicted 612
3 SASI_Mm02_00436266 predicted 1846
4 SASI_Mm02_00436267 predicted 1827
5 SASI_Mm02_00436268 predicted 790
6 SASI_Mm02_00436269 predicted 1842
7 SASI_Mm02_00436270 predicted 1764
8 SASI_Mm02_00436271 predicted 1081
9 SASI_Mm02_00436272 predicted 1830
10 SASI_Mm02_00436273 predicted 1769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451730 predicted 2683
2 SASI_Mm02_00451731 predicted 2727
3 SASI_Mm02_00451732 predicted 2678
4 SASI_Mm02_00451733 predicted 2778
5 SASI_Mm02_00451734 predicted 2834
6 SASI_Mm02_00451735 predicted 2675
7 SASI_Mm02_00451736 predicted 2738
8 SASI_Mm02_00451737 predicted 2702
9 SASI_Mm02_00451738 predicted 2692
10 SASI_Mm02_00451739 predicted 2841
11 SASI_Mm01_00278185 predicted 1924
12 SASI_Mm01_00278186 predicted 745
13 SASI_Mm01_00278187 predicted 1974
14 SASI_Mm01_00278188 predicted 1961
15 SASI_Mm01_00278189 predicted 922
16 SASI_Mm01_00278190 predicted 1968
17 SASI_Mm01_00278191 predicted 1897
18 SASI_Mm01_00278192 predicted 1213
19 SASI_Mm01_00278193 predicted 1900
20 SASI_Mm01_00278194 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152327
VALIDATED
AK7 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 7
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-979s1c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1725s1c1
Sequence:CCGGCGGGACATCAATATCGACGATCTCGAGATCGTCGATATTGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-1398s1c1
Sequence:CCGGGCAGGTCAACTAGACGATCAACTCGAGTTGATCGTCTAGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-368s1c1
Sequence:CCGGCCTGCTGGAGTGTGATGTTATCTCGAGATAACATCACACTCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-1786s1c1
Sequence:CCGGCGATACATATTGATGTAGGAACTCGAGTTCCTACATCAATATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2250s1c1
Sequence:CCGGGAACCACAGATCACTTATTATCTCGAGATAATAAGTGATCTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1564s1c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-1143s1c1
Sequence:CCGGCCAATCAAGATCTGCATTCTTCTCGAGAAGAATGCAGATCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-542s1c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-2116s1c1
Sequence:CCGGCTCTTATTCAGGGCCTGAATGCTCGAGCATTCAGGCCCTGAATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-583s1c1
Sequence:CCGGGAAGAAAGTCTCATCCTAATTCTCGAGAATTAGGATGAGACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-2178s1c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2428s1c1
Sequence:CCGGGCATAGCTCATGAGACAAATACTCGAGTATTTGTCTCATGAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-979s21c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-1564s21c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-2178s21c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-542s21c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152327
VALIDATED
AK7 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 7
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-979s1c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1725s1c1
Sequence:CCGGCGGGACATCAATATCGACGATCTCGAGATCGTCGATATTGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-1398s1c1
Sequence:CCGGGCAGGTCAACTAGACGATCAACTCGAGTTGATCGTCTAGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-368s1c1
Sequence:CCGGCCTGCTGGAGTGTGATGTTATCTCGAGATAACATCACACTCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-1786s1c1
Sequence:CCGGCGATACATATTGATGTAGGAACTCGAGTTCCTACATCAATATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2250s1c1
Sequence:CCGGGAACCACAGATCACTTATTATCTCGAGATAATAAGTGATCTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1564s1c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-1143s1c1
Sequence:CCGGCCAATCAAGATCTGCATTCTTCTCGAGAAGAATGCAGATCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-542s1c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-2116s1c1
Sequence:CCGGCTCTTATTCAGGGCCTGAATGCTCGAGCATTCAGGCCCTGAATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-583s1c1
Sequence:CCGGGAAGAAAGTCTCATCCTAATTCTCGAGAATTAGGATGAGACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-2178s1c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2428s1c1
Sequence:CCGGGCATAGCTCATGAGACAAATACTCGAGTATTTGTCTCATGAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-979s21c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-1564s21c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-2178s21c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-542s21c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152327
VALIDATED
AK7 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 7
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-979s1c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1725s1c1
Sequence:CCGGCGGGACATCAATATCGACGATCTCGAGATCGTCGATATTGATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-1398s1c1
Sequence:CCGGGCAGGTCAACTAGACGATCAACTCGAGTTGATCGTCTAGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152327.1-368s1c1
Sequence:CCGGCCTGCTGGAGTGTGATGTTATCTCGAGATAACATCACACTCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-1786s1c1
Sequence:CCGGCGATACATATTGATGTAGGAACTCGAGTTCCTACATCAATATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2250s1c1
Sequence:CCGGGAACCACAGATCACTTATTATCTCGAGATAATAAGTGATCTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-1564s1c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-1143s1c1
Sequence:CCGGCCAATCAAGATCTGCATTCTTCTCGAGAAGAATGCAGATCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-542s1c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-2116s1c1
Sequence:CCGGCTCTTATTCAGGGCCTGAATGCTCGAGCATTCAGGCCCTGAATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152327.1-583s1c1
Sequence:CCGGGAAGAAAGTCTCATCCTAATTCTCGAGAATTAGGATGAGACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152327.1-2178s1c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152327.1-2428s1c1
Sequence:CCGGGCATAGCTCATGAGACAAATACTCGAGTATTTGTCTCATGAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-979s21c1
Sequence:CCGGCCAAGGACTTAACGCAAGATTCTCGAGAATCTTGCGTTAAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-1564s21c1
Sequence:CCGGGCAGAATGTTTCCCTTTGATACTCGAGTATCAAAGGGAAACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-2178s21c1
Sequence:CCGGGCAGAATATCTCTTCAAGAACCTCGAGGTTCTTGAAGAGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152327.2-542s21c1
Sequence:CCGGCGAGGATTCTGAGGTTCCATTCTCGAGAATGGAACCTCAGAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030187
AK7 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-456s21c1
Sequence:CCGGCTTCGCTGTGGAGGCTTATAACTCGAGTTATAAGCCTCCACAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030187.1-2538s21c1
Sequence:CCGGTGAATAACTGCTATCTCATTGCTCGAGCAATGAGATAGCAGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1542s21c1
Sequence:CCGGTCGGCTAGAAGACCAATATATCTCGAGATATATTGGTCTTCTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1995s21c1
Sequence:CCGGGATCGGGAAGCCTCGGAATTACTCGAGTAATTCCGAGGCTTCCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-516s21c1
Sequence:CCGGGTGCGATGCTGTCATCTATAACTCGAGTTATAGATGACAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030187
AK7 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-456s21c1
Sequence:CCGGCTTCGCTGTGGAGGCTTATAACTCGAGTTATAAGCCTCCACAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030187.1-2538s21c1
Sequence:CCGGTGAATAACTGCTATCTCATTGCTCGAGCAATGAGATAGCAGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1542s21c1
Sequence:CCGGTCGGCTAGAAGACCAATATATCTCGAGATATATTGGTCTTCTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1995s21c1
Sequence:CCGGGATCGGGAAGCCTCGGAATTACTCGAGTAATTCCGAGGCTTCCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-516s21c1
Sequence:CCGGGTGCGATGCTGTCATCTATAACTCGAGTTATAGATGACAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030187
AK7 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-456s21c1
Sequence:CCGGCTTCGCTGTGGAGGCTTATAACTCGAGTTATAAGCCTCCACAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030187.1-2538s21c1
Sequence:CCGGTGAATAACTGCTATCTCATTGCTCGAGCAATGAGATAGCAGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1542s21c1
Sequence:CCGGTCGGCTAGAAGACCAATATATCTCGAGATATATTGGTCTTCTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-1995s21c1
Sequence:CCGGGATCGGGAAGCCTCGGAATTACTCGAGTAATTCCGAGGCTTCCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030187.1-516s21c1
Sequence:CCGGGTGCGATGCTGTCATCTATAACTCGAGTTATAGATGACAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks