EMAIL THIS PAGE TO A FRIEND

AK9

adenylate kinase 9

70 Gene Product Result for
Synonyms: AKD1 AKD2 C6orf199 C6orf224 RP1-70A9.1 dJ70A9.1
Species: Human AK9(221264), Mouse Ak9(633979), Zebrafish ak9(557629)
Gene ID:
Mouse(633979) adenylate kinase 9
Zebrafish(557629) adenylate kinase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031779 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA030804 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA030805 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA031781 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA036324 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA036711 Anti-AK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1104006 Anti-AKD1 (1-15) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2100311 Anti-C6ORF199 (ab1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, human
western blot pricing
SAB2100312 Anti-C6ORF199 (ab2) antibody produced in rabbit affinity isolated antibody rabbit, horse, guinea pig, human
western blot pricing
SAB1402672 Monoclonal Anti-C6ORF199, (C-terminal) antibody produced in mouse clone 1H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145025 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003031 MISSION® esiRNA esiRNA targeting human C6orf199 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145025 Rosetta Predictions human pricing
XR_032514 Rosetta Predictions mouse pricing
XR_035504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224243 predicted 1042
2 SASI_Hs02_00364885 predicted 922
3 SASI_Hs02_00364886 predicted 245
4 SASI_Hs01_00224245 predicted 944
5 SASI_Hs01_00224246 predicted 908
6 SASI_Hs01_00224247 predicted 1025
7 SASI_Hs01_00224248 predicted 390
8 SASI_Hs01_00224249 predicted 954
9 SASI_Hs01_00224250 predicted 324
10 SASI_Hs01_00224251 predicted 403
11 SASI_Hs01_00224244 predicted 1023
12 SASI_Hs01_00224252 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00465659 predicted 1268
2 SASI_Mm02_00465660 predicted 3653
3 SASI_Mm02_00465661 predicted 4961
4 SASI_Mm02_00465662 predicted 4691
5 SASI_Mm02_00465663 predicted 4085
6 SASI_Mm02_00465664 predicted 1425
7 SASI_Mm02_00465665 predicted 4126
8 SASI_Mm02_00465666 predicted 1308
9 SASI_Mm02_00465667 predicted 3485
10 SASI_Mm02_00465668 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483253 predicted 1700
2 SASI_Mm02_00483254 predicted 1563
3 SASI_Mm02_00483255 predicted 2874
4 SASI_Mm02_00483256 predicted 2602
5 SASI_Mm02_00483257 predicted 1994
6 SASI_Mm02_00483258 predicted 2972
7 SASI_Mm02_00483259 predicted 2037
8 SASI_Mm02_00483260 predicted 1400
9 SASI_Mm02_00483261 predicted 2532
10 SASI_Mm02_00483262 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145025
VALIDATED
AK9 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-293s1c1
Sequence:CCGGGCTGAAACCGAATCAGGAGTTCTCGAGAACTCCTGATTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-707s1c1
Sequence:CCGGGAAGAGGCATTTATTGCCGAACTCGAGTTCGGCAATAAATGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-239s1c1
Sequence:CCGGGCATGGAAATGTATTCGTGTTCTCGAGAACACGAATACATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2203s1c1
Sequence:CCGGCCTCTCATGTTTCTTCTCAATCTCGAGATTGAGAAGAAACATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-1055s1c1
Sequence:CCGGGCACCAAGATACAGATGGCAACTCGAGTTGCCATCTGTATCTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-396s1c1
Sequence:CCGGCAGAAGTCTGTCACTTTGGTTCTCGAGAACCAAAGTGACAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-1701s1c1
Sequence:CCGGCCTGTCCTAATTCTTGGTGATCTCGAGATCACCAAGAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2166s1c1
Sequence:CCGGCCAGGTCAAATCTGGAATGTTCTCGAGAACATTCCAGATTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-453s1c1
Sequence:CCGGCCATGACTACCTTACAGCAAACTCGAGTTTGCTGTAAGGTAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-546s1c1
Sequence:CCGGGCCAGAGAATTTCTGGGCAAACTCGAGTTTGCCCAGAAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145025
VALIDATED
AK9 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-293s1c1
Sequence:CCGGGCTGAAACCGAATCAGGAGTTCTCGAGAACTCCTGATTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-707s1c1
Sequence:CCGGGAAGAGGCATTTATTGCCGAACTCGAGTTCGGCAATAAATGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-239s1c1
Sequence:CCGGGCATGGAAATGTATTCGTGTTCTCGAGAACACGAATACATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2203s1c1
Sequence:CCGGCCTCTCATGTTTCTTCTCAATCTCGAGATTGAGAAGAAACATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-1055s1c1
Sequence:CCGGGCACCAAGATACAGATGGCAACTCGAGTTGCCATCTGTATCTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-396s1c1
Sequence:CCGGCAGAAGTCTGTCACTTTGGTTCTCGAGAACCAAAGTGACAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-1701s1c1
Sequence:CCGGCCTGTCCTAATTCTTGGTGATCTCGAGATCACCAAGAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2166s1c1
Sequence:CCGGCCAGGTCAAATCTGGAATGTTCTCGAGAACATTCCAGATTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-453s1c1
Sequence:CCGGCCATGACTACCTTACAGCAAACTCGAGTTTGCTGTAAGGTAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-546s1c1
Sequence:CCGGGCCAGAGAATTTCTGGGCAAACTCGAGTTTGCCCAGAAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145025
VALIDATED
AK9 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-293s1c1
Sequence:CCGGGCTGAAACCGAATCAGGAGTTCTCGAGAACTCCTGATTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-707s1c1
Sequence:CCGGGAAGAGGCATTTATTGCCGAACTCGAGTTCGGCAATAAATGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-239s1c1
Sequence:CCGGGCATGGAAATGTATTCGTGTTCTCGAGAACACGAATACATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2203s1c1
Sequence:CCGGCCTCTCATGTTTCTTCTCAATCTCGAGATTGAGAAGAAACATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145025.2-1055s1c1
Sequence:CCGGGCACCAAGATACAGATGGCAACTCGAGTTGCCATCTGTATCTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-396s1c1
Sequence:CCGGCAGAAGTCTGTCACTTTGGTTCTCGAGAACCAAAGTGACAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-1701s1c1
Sequence:CCGGCCTGTCCTAATTCTTGGTGATCTCGAGATCACCAAGAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145025.2-2166s1c1
Sequence:CCGGCCAGGTCAAATCTGGAATGTTCTCGAGAACATTCCAGATTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145025.2-453s1c1
Sequence:CCGGCCATGACTACCTTACAGCAAACTCGAGTTTGCTGTAAGGTAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145025.2-546s1c1
Sequence:CCGGGCCAGAGAATTTCTGGGCAAACTCGAGTTTGCCCAGAAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks