EMAIL THIS PAGE TO A FRIEND

AKAP10

A kinase (PRKA) anchor protein 10

Synonyms: AKAP-10 D-AKAP-2 D-AKAP2 PRKA10
UniProtKB ID: O43572, B2R650, Q96AJ7
Gene ID:
Human(11216) Summary: This gene encodes a member of the A-kinase anchor protein family. A-kinase anchor proteins bind to the regulatory subunits of protein kinase A (PKA) and confine the holoenzyme to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. Polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2012]
Mouse(56697) A kinase (PRKA) anchor protein 10
Rat(360540) A kinase (PRKA) anchor protein 10
sheep(101118286) A kinase (PRKA) anchor protein 10
Domestic Rabbit(100352866) A kinase (PRKA) anchor protein 10
domestic guinea pig(100727291) A kinase (PRKA) anchor protein 10
naked mole-rat(101701260) A kinase (PRKA) anchor protein 10
Zebrafish(566920) A kinase (PRKA) anchor protein 10
chicken(417612) A kinase (PRKA) anchor protein 10
Horse(100073152) A kinase (PRKA) anchor protein 10
cow(513802) A kinase (PRKA) anchor protein 10
domestic cat(101096118) A kinase (PRKA) anchor protein 10
dog(609073) A kinase (PRKA) anchor protein 10
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007202 Rosetta Predictions human pricing
NM_001114606 Rosetta Predictions rat pricing
XM_001077273 Rosetta Predictions rat pricing
NM_019921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081215 predicted 1065
2 SASI_Hs01_00081216 predicted 334
3 SASI_Hs01_00081217 predicted 2210
4 SASI_Hs01_00081218 predicted 509
5 SASI_Hs01_00081219 predicted 530
6 SASI_Hs01_00081220 predicted 1078
7 SASI_Hs01_00081221 predicted 635
8 SASI_Hs01_00081222 predicted 709
9 SASI_Hs01_00081223 predicted 2102
10 SASI_Hs02_00343184 predicted 1585
11 SASI_Hs01_00081214 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252333 predicted 952
2 SASI_Rn02_00252334 predicted 2061
3 SASI_Rn02_00252335 predicted 363
4 SASI_Rn02_00252336 predicted 267
5 SASI_Rn02_00252337 predicted 641
6 SASI_Rn02_00252338 predicted 1617
7 SASI_Rn02_00252339 predicted 660
8 SASI_Rn02_00252340 predicted 292
9 SASI_Rn02_00252341 predicted 511
10 SASI_Rn02_00252342 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356520 predicted 952
2 SASI_Rn02_00356521 predicted 2056
3 SASI_Rn02_00356522 predicted 360
4 SASI_Rn02_00356523 predicted 267
5 SASI_Rn02_00356524 predicted 646
6 SASI_Rn02_00356525 predicted 1608
7 SASI_Rn02_00356526 predicted 658
8 SASI_Rn02_00356527 predicted 297
9 SASI_Rn02_00356528 predicted 514
10 SASI_Rn02_00356529 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043898 predicted 2048
2 SASI_Mm01_00043899 predicted 1522
3 SASI_Mm01_00043900 predicted 2141
4 SASI_Mm01_00043902 predicted 586
5 SASI_Mm01_00043903 predicted 1601
6 SASI_Mm02_00325197 predicted 919
7 SASI_Mm01_00043904 predicted 647
8 SASI_Mm02_00325198 predicted 544
9 SASI_Mm01_00043905 predicted 497
10 SASI_Mm01_00043907 predicted 2118
11 SASI_Mm01_00043901 predicted 666
12 SASI_Mm01_00043906 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007202
AKAP10 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1863s21c1
Sequence:CCGGTCTTTATATCAACGGACATATCTCGAGATATGTCCGTTGATATAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007202.2-2291s21c1
Sequence:CCGGAGTTACCTGTAGGCATAATTGCTCGAGCAATTATGCCTACAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-625s21c1
Sequence:CCGGCAACAACTTGGTCGCGAATAACTCGAGTTATTCGCGACCAAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1668s21c1
Sequence:CCGGTCGGTTCGAGGAGATGAATTTCTCGAGAAATTCATCTCCTCGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-710s1c1
Sequence:CCGGGCATGAAACTACAGCGTCTTTCTCGAGAAAGACGCTGTAGTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1092s1c1
Sequence:CCGGGCAATGAGAAATGACATCATACTCGAGTATGATGTCATTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1989s1c1
Sequence:CCGGGCTATGAAGAAATGGGTGCAACTCGAGTTGCACCCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-2085s1c1
Sequence:CCGGGCTCAGTATGATCAACCGTTACTCGAGTAACGGTTGATCATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-530s1c1
Sequence:CCGGCGACACTATTGTCCTCCCTTACTCGAGTAAGGGAGGACAATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007202
AKAP10 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1863s21c1
Sequence:CCGGTCTTTATATCAACGGACATATCTCGAGATATGTCCGTTGATATAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007202.2-2291s21c1
Sequence:CCGGAGTTACCTGTAGGCATAATTGCTCGAGCAATTATGCCTACAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-625s21c1
Sequence:CCGGCAACAACTTGGTCGCGAATAACTCGAGTTATTCGCGACCAAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1668s21c1
Sequence:CCGGTCGGTTCGAGGAGATGAATTTCTCGAGAAATTCATCTCCTCGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-710s1c1
Sequence:CCGGGCATGAAACTACAGCGTCTTTCTCGAGAAAGACGCTGTAGTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1092s1c1
Sequence:CCGGGCAATGAGAAATGACATCATACTCGAGTATGATGTCATTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1989s1c1
Sequence:CCGGGCTATGAAGAAATGGGTGCAACTCGAGTTGCACCCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-2085s1c1
Sequence:CCGGGCTCAGTATGATCAACCGTTACTCGAGTAACGGTTGATCATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-530s1c1
Sequence:CCGGCGACACTATTGTCCTCCCTTACTCGAGTAAGGGAGGACAATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007202
AKAP10 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1863s21c1
Sequence:CCGGTCTTTATATCAACGGACATATCTCGAGATATGTCCGTTGATATAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007202.2-2291s21c1
Sequence:CCGGAGTTACCTGTAGGCATAATTGCTCGAGCAATTATGCCTACAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-625s21c1
Sequence:CCGGCAACAACTTGGTCGCGAATAACTCGAGTTATTCGCGACCAAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007202.2-1668s21c1
Sequence:CCGGTCGGTTCGAGGAGATGAATTTCTCGAGAAATTCATCTCCTCGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-710s1c1
Sequence:CCGGGCATGAAACTACAGCGTCTTTCTCGAGAAAGACGCTGTAGTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1092s1c1
Sequence:CCGGGCAATGAGAAATGACATCATACTCGAGTATGATGTCATTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-1989s1c1
Sequence:CCGGGCTATGAAGAAATGGGTGCAACTCGAGTTGCACCCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-2085s1c1
Sequence:CCGGGCTCAGTATGATCAACCGTTACTCGAGTAACGGTTGATCATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007202.2-530s1c1
Sequence:CCGGCGACACTATTGTCCTCCCTTACTCGAGTAAGGGAGGACAATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019921
VALIDATED
AKAP10 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-639s21c1
Sequence:CCGGTACAACGTGGTCCCGAATAAGCTCGAGCTTATTCGGGACCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1206s21c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-2002s21c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-352s21c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1373s21c1
Sequence:CCGGTCTGGTTAGCAGCGGATAATTCTCGAGAATTATCCGCTGCTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019921.2-229s1c1
Sequence:CCGGCGGCGGAAAGTGAAAGGTAAACTCGAGTTTACCTTTCACTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-1206s1c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019921.2-3517s1c1
Sequence:CCGGGCTCTCCTGTTGAAGTATATTCTCGAGAATATACTTCAACAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-352s1c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-2002s1c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019921
VALIDATED
AKAP10 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-639s21c1
Sequence:CCGGTACAACGTGGTCCCGAATAAGCTCGAGCTTATTCGGGACCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1206s21c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-2002s21c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-352s21c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1373s21c1
Sequence:CCGGTCTGGTTAGCAGCGGATAATTCTCGAGAATTATCCGCTGCTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019921.2-229s1c1
Sequence:CCGGCGGCGGAAAGTGAAAGGTAAACTCGAGTTTACCTTTCACTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-1206s1c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019921.2-3517s1c1
Sequence:CCGGGCTCTCCTGTTGAAGTATATTCTCGAGAATATACTTCAACAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-352s1c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-2002s1c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019921
VALIDATED
AKAP10 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-639s21c1
Sequence:CCGGTACAACGTGGTCCCGAATAAGCTCGAGCTTATTCGGGACCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1206s21c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-2002s21c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-352s21c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019921.2-1373s21c1
Sequence:CCGGTCTGGTTAGCAGCGGATAATTCTCGAGAATTATCCGCTGCTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019921.2-229s1c1
Sequence:CCGGCGGCGGAAAGTGAAAGGTAAACTCGAGTTTACCTTTCACTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-1206s1c1
Sequence:CCGGGCAAGAGCACTTTAGTGAGTTCTCGAGAACTCACTAAAGTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019921.2-3517s1c1
Sequence:CCGGGCTCTCCTGTTGAAGTATATTCTCGAGAATATACTTCAACAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-352s1c1
Sequence:CCGGCCAAGTCATGTTGCGATCAATCTCGAGATTGATCGCAACATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019921.2-2002s1c1
Sequence:CCGGGCTATGAAGAAGTGGGTGCAACTCGAGTTGCACCCACTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks