EMAIL THIS PAGE TO A FRIEND

AKAP11

A kinase (PRKA) anchor protein 11

243 Gene Product Result for
Synonyms: AKAP-11 AKAP220 PPP1R44 PRKA11
UniProtKB ID: Q9UKA4, O75124, Q9NUK7
Gene ID:
Human(11215) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
Mouse(219181) A kinase (PRKA) anchor protein 11
Rat(498549) A kinase (PRKA) anchor protein 11
Zebrafish(558595) A kinase (PRKA) anchor protein 11
cow(533105) A kinase (PRKA) anchor protein 11
Horse(100060352) A kinase (PRKA) anchor protein 11
domestic cat(101087548) A kinase (PRKA) anchor protein 11
chicken(418835) A kinase (PRKA) anchor protein 11
dog(609431) A kinase (PRKA) anchor protein 11
naked mole-rat(101697069) A kinase (PRKA) anchor protein 11
domestic guinea pig(100712954) A kinase (PRKA) anchor protein 11
sheep(101108581) A kinase (PRKA) anchor protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001002157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001002157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001002157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU185981 MISSION® esiRNA esiRNA targeting mouse Akap11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016248 Rosetta Predictions human pricing
NM_144490 Rosetta Predictions human pricing
NM_012773 Rosetta Predictions rat pricing
XM_001002157 Rosetta Predictions mouse pricing
XM_915278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102405 predicted 270
2 SASI_Hs01_00102406 predicted 563
3 SASI_Hs01_00102407 predicted 2976
4 SASI_Hs01_00102408 predicted 3489
5 SASI_Hs02_00349126 predicted 4817
6 SASI_Hs02_00349127 predicted 4909
7 SASI_Hs01_00102410 predicted 4107
8 SASI_Hs02_00349128 predicted 3503
9 SASI_Hs01_00102411 predicted 596
10 SASI_Hs02_00349129 predicted 5305
11 SASI_Hs01_00102409 predicted 938
12 SASI_Hs01_00102412 predicted 4062
13 SASI_Hs01_00102413 predicted 1422
14 SASI_Hs01_00102414 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224043 predicted 283
2 SASI_Hs01_00224044 predicted 571
3 SASI_Hs01_00224045 predicted 2979
4 SASI_Hs01_00224046 predicted 3490
5 SASI_Hs01_00224047 predicted 931
6 SASI_Hs01_00224048 predicted 4107
7 SASI_Hs01_00224049 predicted 606
8 SASI_Hs01_00224050 predicted 4065
9 SASI_Hs01_00224051 predicted 1428
10 SASI_Hs01_00224052 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260161 predicted 3626
2 SASI_Rn02_00260162 predicted 668
3 SASI_Rn02_00260163 predicted 2541
4 SASI_Rn02_00260164 predicted 3814
5 SASI_Rn02_00260165 predicted 3784
6 SASI_Rn02_00260166 predicted 1118
7 SASI_Rn02_00260167 predicted 3544
8 SASI_Rn02_00260168 predicted 5360
9 SASI_Rn02_00260169 predicted 2808
10 SASI_Rn02_00260170 predicted 3740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227946 predicted 2734
2 SASI_Mm01_00227947 predicted 3180
3 SASI_Mm01_00227948 predicted 1931
4 SASI_Mm01_00227949 predicted 4101
5 SASI_Mm01_00227950 predicted 4188
6 SASI_Mm01_00227951 predicted 3000
7 SASI_Mm01_00227952 predicted 1935
8 SASI_Mm01_00227953 predicted 5182
9 SASI_Mm01_00227954 predicted 2457
10 SASI_Mm01_00227955 predicted 5170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439311 predicted 2731
2 SASI_Mm02_00439312 predicted 3184
3 SASI_Mm02_00439313 predicted 4092
4 SASI_Mm02_00439314 predicted 4188
5 SASI_Mm02_00439315 predicted 2995
6 SASI_Mm02_00439316 predicted 1934
7 SASI_Mm02_00439317 predicted 5181
8 SASI_Mm02_00439318 predicted 2453
9 SASI_Mm02_00439319 predicted 5169
10 SASI_Mm02_00439320 predicted 3841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016248
VALIDATED
AKAP11 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-5126s1c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-1190s1c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-4245s1c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016248.x-6706s1c1
Sequence:CCGGGCCTATAAAGATTGTGCAGTACTCGAGTACTGCACAATCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-3611s1c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6238s21c1
Sequence:GTACCGGAGGTTCCAGTGATAGAGTTATCTCGAGATAACTCTATCACTGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-1190s21c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6025s21c1
Sequence:CCGGGTGTTATCACTCGGTGTATATCTCGAGATATACACCGAGTGATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-5126s21c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-4245s21c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-3611s21c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016248
VALIDATED
AKAP11 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-5126s1c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-1190s1c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-4245s1c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016248.x-6706s1c1
Sequence:CCGGGCCTATAAAGATTGTGCAGTACTCGAGTACTGCACAATCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-3611s1c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6238s21c1
Sequence:GTACCGGAGGTTCCAGTGATAGAGTTATCTCGAGATAACTCTATCACTGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-1190s21c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6025s21c1
Sequence:CCGGGTGTTATCACTCGGTGTATATCTCGAGATATACACCGAGTGATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-5126s21c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-4245s21c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-3611s21c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016248
VALIDATED
AKAP11 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-5126s1c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-1190s1c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-4245s1c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016248.x-6706s1c1
Sequence:CCGGGCCTATAAAGATTGTGCAGTACTCGAGTACTGCACAATCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016248.x-3611s1c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6238s21c1
Sequence:GTACCGGAGGTTCCAGTGATAGAGTTATCTCGAGATAACTCTATCACTGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-1190s21c1
Sequence:CCGGCCTGTGATGAAAGATGATATACTCGAGTATATCATCTTTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-6025s21c1
Sequence:CCGGGTGTTATCACTCGGTGTATATCTCGAGATATACACCGAGTGATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-5126s21c1
Sequence:CCGGGCTGAGAAGATAGTTGCTGAACTCGAGTTCAGCAACTATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016248.2-4245s21c1
Sequence:CCGGGTGGTAATAGTGAGTTGATAACTCGAGTTATCAACTCACTATTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016248.2-3611s21c1
Sequence:CCGGGTTGGTAGTTTGTCTGAGAATCTCGAGATTCTCAGACAAACTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001002157
VALIDATED
AKAP11 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002157.2-9010s21c1
Sequence:CCGGGTATGGTTTGGATACTATTTACTCGAGTAAATAGTATCCAAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-4194s21c1
Sequence:CCGGTGAGTATGCAGGGCATGTTATCTCGAGATAACATGCCCTGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-1870s21c1
Sequence:CCGGAGTTTGGGCAGTGCGTTTAAACTCGAGTTTAAACGCACTGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-5624s21c1
Sequence:CCGGACCCGCAATTAAGGATTATTCCTCGAGGAATAATCCTTAATTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002157.2-3000s21c1
Sequence:CCGGGCAGTTATCAAAGTCTATTATCTCGAGATAATAGACTTTGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001002157
VALIDATED
AKAP11 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002157.2-9010s21c1
Sequence:CCGGGTATGGTTTGGATACTATTTACTCGAGTAAATAGTATCCAAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-4194s21c1
Sequence:CCGGTGAGTATGCAGGGCATGTTATCTCGAGATAACATGCCCTGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-1870s21c1
Sequence:CCGGAGTTTGGGCAGTGCGTTTAAACTCGAGTTTAAACGCACTGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-5624s21c1
Sequence:CCGGACCCGCAATTAAGGATTATTCCTCGAGGAATAATCCTTAATTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002157.2-3000s21c1
Sequence:CCGGGCAGTTATCAAAGTCTATTATCTCGAGATAATAGACTTTGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001002157
VALIDATED
AKAP11 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002157.2-9010s21c1
Sequence:CCGGGTATGGTTTGGATACTATTTACTCGAGTAAATAGTATCCAAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-4194s21c1
Sequence:CCGGTGAGTATGCAGGGCATGTTATCTCGAGATAACATGCCCTGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-1870s21c1
Sequence:CCGGAGTTTGGGCAGTGCGTTTAAACTCGAGTTTAAACGCACTGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002157.2-5624s21c1
Sequence:CCGGACCCGCAATTAAGGATTATTCCTCGAGGAATAATCCTTAATTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002157.2-3000s21c1
Sequence:CCGGGCAGTTATCAAAGTCTATTATCTCGAGATAATAGACTTTGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks