EMAIL THIS PAGE TO A FRIEND

AKAP12

A kinase (PRKA) anchor protein 12

90 Gene Product Result for
Synonyms: AKAP250 SSeCKS
Gene ID:
Human(9590) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(83397) A kinase (PRKA) anchor protein (gravin) 12
Rat(83425) A kinase (PRKA) anchor protein 12
sheep(101105509) A kinase (PRKA) anchor protein 12
domestic guinea pig(100733313) A kinase (PRKA) anchor protein 12
naked mole-rat(101719181) A kinase (PRKA) anchor protein 12
chicken(421634) A kinase (PRKA) anchor protein 12
dog(476246) A kinase (PRKA) anchor protein 12
Horse(100063263) A kinase (PRKA) anchor protein 12
cow(513774) A kinase (PRKA) anchor protein 12
domestic cat(101083007) A kinase (PRKA) anchor protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005100 Rosetta Predictions human pricing
NM_144497 Rosetta Predictions human pricing
NM_001033653 Rosetta Predictions rat pricing
NM_057103 Rosetta Predictions rat pricing
NM_031185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175942 predicted 4267
2 SASI_Hs01_00175943 predicted 5123
3 SASI_Hs01_00175944 predicted 4653
4 SASI_Hs02_00338981 predicted 4107
5 SASI_Hs01_00175946 predicted 4187
6 SASI_Hs01_00175948 predicted 2534
7 SASI_Hs01_00175949 predicted 2205
8 SASI_Hs02_00338982 predicted 3081
9 SASI_Hs02_00338983 predicted 5498
10 SASI_Hs02_00338984 predicted 2047
11 SASI_Hs01_00175940 predicted 4892
12 SASI_Hs01_00175941 predicted 715
13 SASI_Hs01_00175945 predicted 5543
14 SASI_Hs01_00175947 predicted 5519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126786 predicted 3955
2 SASI_Hs01_00126787 predicted 4806
3 SASI_Hs01_00126788 predicted 4340
4 SASI_Hs02_00364318 predicted 3794
5 SASI_Hs01_00126790 predicted 3878
6 SASI_Hs01_00126792 predicted 2222
7 SASI_Hs01_00126793 predicted 1888
8 SASI_Hs02_00364319 predicted 2772
9 SASI_Hs02_00364320 predicted 5185
10 SASI_Hs02_00364321 predicted 1742
11 SASI_Hs01_00126784 predicted 4590
12 SASI_Hs01_00126785 predicted 397
13 SASI_Hs01_00126789 predicted 5234
14 SASI_Hs01_00126791 predicted 5212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074066 predicted 2725
2 SASI_Rn01_00074067 predicted 3494
3 SASI_Rn01_00074070 predicted 3480
4 SASI_Rn01_00074071 predicted 2257
5 SASI_Rn01_00074072 predicted 2855
6 SASI_Rn01_00074073 predicted 2276
7 SASI_Rn02_00203652 predicted 4425
8 SASI_Rn02_00203653 predicted 4498
9 SASI_Rn01_00074074 predicted 2598
10 SASI_Rn01_00074075 predicted 4264
11 SASI_Rn01_00074068 predicted 1668
12 SASI_Rn01_00074069 predicted 4235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081355 predicted 2956
2 SASI_Rn01_00081356 predicted 3719
3 SASI_Rn01_00081359 predicted 3707
4 SASI_Rn01_00081360 predicted 2480
5 SASI_Rn01_00081361 predicted 3083
6 SASI_Rn01_00081362 predicted 2504
7 SASI_Rn02_00267034 predicted 4658
8 SASI_Rn02_00267035 predicted 4727
9 SASI_Rn01_00081363 predicted 2822
10 SASI_Rn01_00081364 predicted 4502
11 SASI_Rn01_00081357 predicted 1898
12 SASI_Rn01_00081358 predicted 4455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079719 predicted 4943
2 SASI_Mm01_00079720 predicted 4647
3 SASI_Mm01_00079722 predicted 5185
4 SASI_Mm01_00079724 predicted 4002
5 SASI_Mm01_00079725 predicted 2121
6 SASI_Mm01_00079726 predicted 1728
7 SASI_Mm01_00079727 predicted 2646
8 SASI_Mm02_00337027 predicted 5226
9 SASI_Mm01_00079728 predicted 3865
10 SASI_Mm02_00337028 predicted 2546
11 SASI_Mm01_00079721 predicted 2609
12 SASI_Mm01_00079723 predicted 5145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031185
AKAP12 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-645s21c1
Sequence:CCGGTCGGCTTCAAGAAGGTATTTACTCGAGTAAATACCTTCTTGAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-552s21c1
Sequence:CCGGAGGAGGAAACACCGGAAATAACTCGAGTTATTTCCGGTGTTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031185.3-5415s21c1
Sequence:CCGGAGCTAGAGCCAGCTAACATTTCTCGAGAAATGTTAGCTGGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031185.1-5371s1c1
Sequence:CCGGGCCAGCTAACATTTCCTCTTTCTCGAGAAAGAGGAAATGTTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4940s1c1
Sequence:CCGGGCCAGTGTCAAAGAAAGTGTTCTCGAGAACACTTTCTTTGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4451s1c1
Sequence:CCGGGCAGAGTCCATCCCAATAATACTCGAGTATTATTGGGATGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-1727s1c1
Sequence:CCGGCCAGGAGAATACCAACACATTCTCGAGAATGTGTTGGTATTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-595s1c1
Sequence:CCGGCGGCTTCAAGAAGGTATTTAACTCGAGTTAAATACCTTCTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031185
AKAP12 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-645s21c1
Sequence:CCGGTCGGCTTCAAGAAGGTATTTACTCGAGTAAATACCTTCTTGAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-552s21c1
Sequence:CCGGAGGAGGAAACACCGGAAATAACTCGAGTTATTTCCGGTGTTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031185.3-5415s21c1
Sequence:CCGGAGCTAGAGCCAGCTAACATTTCTCGAGAAATGTTAGCTGGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031185.1-5371s1c1
Sequence:CCGGGCCAGCTAACATTTCCTCTTTCTCGAGAAAGAGGAAATGTTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4940s1c1
Sequence:CCGGGCCAGTGTCAAAGAAAGTGTTCTCGAGAACACTTTCTTTGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4451s1c1
Sequence:CCGGGCAGAGTCCATCCCAATAATACTCGAGTATTATTGGGATGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-1727s1c1
Sequence:CCGGCCAGGAGAATACCAACACATTCTCGAGAATGTGTTGGTATTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-595s1c1
Sequence:CCGGCGGCTTCAAGAAGGTATTTAACTCGAGTTAAATACCTTCTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031185
AKAP12 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-645s21c1
Sequence:CCGGTCGGCTTCAAGAAGGTATTTACTCGAGTAAATACCTTCTTGAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031185.3-552s21c1
Sequence:CCGGAGGAGGAAACACCGGAAATAACTCGAGTTATTTCCGGTGTTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031185.3-5415s21c1
Sequence:CCGGAGCTAGAGCCAGCTAACATTTCTCGAGAAATGTTAGCTGGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031185.1-5371s1c1
Sequence:CCGGGCCAGCTAACATTTCCTCTTTCTCGAGAAAGAGGAAATGTTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4940s1c1
Sequence:CCGGGCCAGTGTCAAAGAAAGTGTTCTCGAGAACACTTTCTTTGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-4451s1c1
Sequence:CCGGGCAGAGTCCATCCCAATAATACTCGAGTATTATTGGGATGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-1727s1c1
Sequence:CCGGCCAGGAGAATACCAACACATTCTCGAGAATGTGTTGGTATTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031185.1-595s1c1
Sequence:CCGGCGGCTTCAAGAAGGTATTTAACTCGAGTTAAATACCTTCTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005100
VALIDATED
AKAP12 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-5820s21c1
Sequence:CCGGTTTCCCTTGATAACCATATAACTCGAGTTATATGGTTATCAAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2506s21c1
Sequence:CCGGGTTTCCACCTGGGAGTCATTTCTCGAGAAATGACTCCCAGGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-735s21c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-4708s21c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2252s21c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005100.2-616s1c1
Sequence:CCGGCCCGAAATAATCGAACAGATTCTCGAGAATCTGTTCGATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-4657s1c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-5370s1c1
Sequence:CCGGCCCAGATACAAATGGACCAAACTCGAGTTTGGTCCATTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-2201s1c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-684s1c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005100
VALIDATED
AKAP12 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-5820s21c1
Sequence:CCGGTTTCCCTTGATAACCATATAACTCGAGTTATATGGTTATCAAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2506s21c1
Sequence:CCGGGTTTCCACCTGGGAGTCATTTCTCGAGAAATGACTCCCAGGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-735s21c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-4708s21c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2252s21c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005100.2-616s1c1
Sequence:CCGGCCCGAAATAATCGAACAGATTCTCGAGAATCTGTTCGATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-4657s1c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-5370s1c1
Sequence:CCGGCCCAGATACAAATGGACCAAACTCGAGTTTGGTCCATTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-2201s1c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-684s1c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005100
VALIDATED
AKAP12 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-5820s21c1
Sequence:CCGGTTTCCCTTGATAACCATATAACTCGAGTTATATGGTTATCAAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2506s21c1
Sequence:CCGGGTTTCCACCTGGGAGTCATTTCTCGAGAAATGACTCCCAGGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-735s21c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-4708s21c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005100.3-2252s21c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005100.2-616s1c1
Sequence:CCGGCCCGAAATAATCGAACAGATTCTCGAGAATCTGTTCGATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-4657s1c1
Sequence:CCGGGCTACTACCAAGAAAGGCTTACTCGAGTAAGCCTTTCTTGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-5370s1c1
Sequence:CCGGCCCAGATACAAATGGACCAAACTCGAGTTTGGTCCATTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-2201s1c1
Sequence:CCGGGCAAGGTGGATACCTCAGTATCTCGAGATACTGAGGTATCCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005100.2-684s1c1
Sequence:CCGGCCAGGCTAATGATATTGGATTCTCGAGAATCCAATATCATTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks