EMAIL THIS PAGE TO A FRIEND

AKAP13

A kinase (PRKA) anchor protein 13

126 Gene Product Result for
Synonyms: AKAP-13 AKAP-Lbc ARHGEF13 BRX HA-3 Ht31 LBC PRKA13 PROTO-LB PROTO-LBC c-lbc p47
Gene ID:
Human(11214) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
Mouse(75547) A kinase (PRKA) anchor protein 13
Rat(293024) A kinase (PRKA) anchor protein 13
Zebrafish(557441) A kinase (PRKA) anchor protein 13
cow(504288) A kinase (PRKA) anchor protein 13
Horse(100070242) A kinase (PRKA) anchor protein 13
domestic cat(101093021) A kinase (PRKA) anchor protein 13
dog(479032) A kinase (PRKA) anchor protein 13
chicken(415502) A kinase (PRKA) anchor protein 13
naked mole-rat(101720563) A kinase (PRKA) anchor protein 13
domestic guinea pig(100733906) A kinase (PRKA) anchor protein 13
sheep(101115486) A kinase (PRKA) anchor protein 13
Domestic Rabbit(100342409) A kinase (PRKA) anchor protein 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006738 Rosetta Predictions human pricing
NM_007200 Rosetta Predictions human pricing
NM_144767 Rosetta Predictions human pricing
NM_001106271 Rosetta Predictions rat pricing
NM_029332 Rosetta Predictions mouse pricing
XM_133543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342183 predicted 7090
2 SASI_Hs01_00203481 predicted 6607
3 SASI_Hs01_00203483 predicted 7648
4 SASI_Hs02_00342184 predicted 6775
5 SASI_Hs01_00203486 predicted 6866
6 SASI_Hs01_00203488 predicted 7418
7 SASI_Hs02_00342185 predicted 8215
8 SASI_Hs02_00342186 predicted 7664
9 SASI_Hs01_00203490 predicted 6624
10 SASI_Hs02_00342187 predicted 6599
11 SASI_Hs01_00203482 predicted 7200
12 SASI_Hs01_00203484 predicted 5928
13 SASI_Hs01_00203485 predicted 5959
14 SASI_Hs01_00203487 predicted 6583
15 SASI_Hs01_00203489 predicted 6018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343179 predicted 7083
2 SASI_Hs01_00148132 predicted 6596
3 SASI_Hs01_00148134 predicted 7635
4 SASI_Hs02_00343180 predicted 6769
5 SASI_Hs01_00148137 predicted 6847
6 SASI_Hs01_00148139 predicted 7409
7 SASI_Hs02_00343181 predicted 8203
8 SASI_Hs02_00343182 predicted 7651
9 SASI_Hs01_00148141 predicted 6606
10 SASI_Hs02_00343183 predicted 6588
11 SASI_Hs01_00148133 predicted 7192
12 SASI_Hs01_00148135 predicted 5915
13 SASI_Hs01_00148136 predicted 5949
14 SASI_Hs01_00148138 predicted 6570
15 SASI_Hs01_00148140 predicted 6008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364707 predicted 1868
2 SASI_Hs01_00221048 predicted 1390
3 SASI_Hs01_00221050 predicted 2429
4 SASI_Hs02_00364708 predicted 1560
5 SASI_Hs01_00221053 predicted 1642
6 SASI_Hs01_00221055 predicted 2198
7 SASI_Hs02_00364709 predicted 2996
8 SASI_Hs02_00364710 predicted 2447
9 SASI_Hs01_00221057 predicted 1401
10 SASI_Hs02_00364711 predicted 1379
11 SASI_Hs01_00221049 predicted 1981
12 SASI_Hs01_00221051 predicted 711
13 SASI_Hs01_00221052 predicted 738
14 SASI_Hs01_00221054 predicted 1361
15 SASI_Hs01_00221056 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217328 predicted 2080
2 SASI_Rn02_00217329 predicted 8440
3 SASI_Rn02_00217330 predicted 8077
4 SASI_Rn02_00217331 predicted 1334
5 SASI_Rn02_00217332 predicted 818
6 SASI_Rn02_00217333 predicted 3808
7 SASI_Rn02_00217334 predicted 847
8 SASI_Rn02_00217335 predicted 4391
9 SASI_Rn02_00217336 predicted 2641
10 SASI_Rn02_00217337 predicted 4720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335158 predicted 8043
2 SASI_Mm02_00335159 predicted 1489
3 SASI_Mm02_00335160 predicted 2696
4 SASI_Mm02_00335161 predicted 3980
5 SASI_Mm02_00335162 predicted 7350
6 SASI_Mm02_00335163 predicted 1810
7 SASI_Mm02_00335164 predicted 5112
8 SASI_Mm02_00335165 predicted 978
9 SASI_Mm02_00335166 predicted 4518
10 SASI_Mm02_00335167 predicted 2875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217355 predicted 8108
2 SASI_Mm01_00217356 predicted 1552
3 SASI_Mm01_00217357 predicted 2755
4 SASI_Mm01_00217358 predicted 1875
5 SASI_Mm01_00217359 predicted 612
6 SASI_Mm01_00217360 predicted 5179
7 SASI_Mm01_00217361 predicted 1046
8 SASI_Mm01_00217362 predicted 2293
9 SASI_Mm01_00217363 predicted 2940
10 SASI_Mm01_00217364 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006738
VALIDATED
AKAP13 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006738.4-5377s1c1
Sequence:CCGGCCTCCAAGAAAGATTCTGAATCTCGAGATTCAGAATCTTTCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-2116s1c1
Sequence:CCGGCCTCACCCATTTGTTCTACAACTCGAGTTGTAGAACAAATGGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-6936s1c1
Sequence:CCGGGCAGTTCTTCTCACTGACATTCTCGAGAATGTCAGTGAGAAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-246s1c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-7669s1c1
Sequence:CCGGCGGAATCAGATAGTGGCCTAACTCGAGTTAGGCCACTATCTGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006738.4-4316s21c1
Sequence:CCGGCCCAATGACCCAGGCGATAAACTCGAGTTTATCGCCTGGGTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-246s21c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-8767s21c1
Sequence:CCGGCAATAAGCAACAGATGATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6102s21c1
Sequence:CCGGGAGTCTTGGAGTCGGATAATACTCGAGTATTATCCGACTCCAAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6443s21c1
Sequence:CCGGTGAGAATGCAGAACGTTTAAACTCGAGTTTAAACGTTCTGCATTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006738
VALIDATED
AKAP13 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006738.4-5377s1c1
Sequence:CCGGCCTCCAAGAAAGATTCTGAATCTCGAGATTCAGAATCTTTCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-2116s1c1
Sequence:CCGGCCTCACCCATTTGTTCTACAACTCGAGTTGTAGAACAAATGGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-6936s1c1
Sequence:CCGGGCAGTTCTTCTCACTGACATTCTCGAGAATGTCAGTGAGAAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-246s1c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-7669s1c1
Sequence:CCGGCGGAATCAGATAGTGGCCTAACTCGAGTTAGGCCACTATCTGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006738.4-4316s21c1
Sequence:CCGGCCCAATGACCCAGGCGATAAACTCGAGTTTATCGCCTGGGTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-246s21c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-8767s21c1
Sequence:CCGGCAATAAGCAACAGATGATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6102s21c1
Sequence:CCGGGAGTCTTGGAGTCGGATAATACTCGAGTATTATCCGACTCCAAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6443s21c1
Sequence:CCGGTGAGAATGCAGAACGTTTAAACTCGAGTTTAAACGTTCTGCATTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006738
VALIDATED
AKAP13 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006738.4-5377s1c1
Sequence:CCGGCCTCCAAGAAAGATTCTGAATCTCGAGATTCAGAATCTTTCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-2116s1c1
Sequence:CCGGCCTCACCCATTTGTTCTACAACTCGAGTTGTAGAACAAATGGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-6936s1c1
Sequence:CCGGGCAGTTCTTCTCACTGACATTCTCGAGAATGTCAGTGAGAAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-246s1c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006738.4-7669s1c1
Sequence:CCGGCGGAATCAGATAGTGGCCTAACTCGAGTTAGGCCACTATCTGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006738.4-4316s21c1
Sequence:CCGGCCCAATGACCCAGGCGATAAACTCGAGTTTATCGCCTGGGTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-246s21c1
Sequence:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-8767s21c1
Sequence:CCGGCAATAAGCAACAGATGATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6102s21c1
Sequence:CCGGGAGTCTTGGAGTCGGATAATACTCGAGTATTATCCGACTCCAAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006738.4-6443s21c1
Sequence:CCGGTGAGAATGCAGAACGTTTAAACTCGAGTTTAAACGTTCTGCATTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029332
VALIDATED
AKAP13 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-6376s21c1
Sequence:CCGGTGAGAGTGCAGAGCGCTTAAACTCGAGTTTAAGCGCTCTGCACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-9145s21c1
Sequence:CCGGACGTATTCCTCATTTCGTTTACTCGAGTAAACGAAATGAGGAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-1803s21c1
Sequence:CCGGCCATGGAGAAAGCCGATATTACTCGAGTAATATCGGCTTTCTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5131s21c1
Sequence:CCGGGTCTAAACAACAGGGATTTAACTCGAGTTAAATCCCTGTTGTTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5255s21c1
Sequence:CCGGGCCAACCTGACCGAGAGTATACTCGAGTATACTCTCGGTCAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029332
VALIDATED
AKAP13 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-6376s21c1
Sequence:CCGGTGAGAGTGCAGAGCGCTTAAACTCGAGTTTAAGCGCTCTGCACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-9145s21c1
Sequence:CCGGACGTATTCCTCATTTCGTTTACTCGAGTAAACGAAATGAGGAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-1803s21c1
Sequence:CCGGCCATGGAGAAAGCCGATATTACTCGAGTAATATCGGCTTTCTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5131s21c1
Sequence:CCGGGTCTAAACAACAGGGATTTAACTCGAGTTAAATCCCTGTTGTTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5255s21c1
Sequence:CCGGGCCAACCTGACCGAGAGTATACTCGAGTATACTCTCGGTCAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029332
VALIDATED
AKAP13 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-6376s21c1
Sequence:CCGGTGAGAGTGCAGAGCGCTTAAACTCGAGTTTAAGCGCTCTGCACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-9145s21c1
Sequence:CCGGACGTATTCCTCATTTCGTTTACTCGAGTAAACGAAATGAGGAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029332.1-1803s21c1
Sequence:CCGGCCATGGAGAAAGCCGATATTACTCGAGTAATATCGGCTTTCTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5131s21c1
Sequence:CCGGGTCTAAACAACAGGGATTTAACTCGAGTTAAATCCCTGTTGTTTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029332.1-5255s21c1
Sequence:CCGGGCCAACCTGACCGAGAGTATACTCGAGTATACTCTCGGTCAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)