EMAIL THIS PAGE TO A FRIEND

AKAP17A

A kinase (PRKA) anchor protein 17A

97 Gene Product Result for
Synonyms: 721P AKAP-17A CCDC133 CXYorf3 DXYS155E PRKA17A SFRS17A XE7 XE7Y
UniProtKB ID: Q02040, Q02832, Q2TB98, Q5JQ74, Q5JQ76, Q8N6U9
Gene ID:
Human(8227) Summary: This locus encodes a protein kinase A anchoring protein. The encoded protein is part of the spliceosome complex and is involved in the regulation of alternate splicing in some mRNA precursors. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Sep 2010]
Rat(288526) A kinase (PRKA) anchor protein 17A
Zebrafish(393655) A kinase (PRKA) anchor protein 17A
chicken(418664) A kinase (PRKA) anchor protein 17A
dog(491712) A kinase (PRKA) anchor protein 17A
cow(100850391) A kinase (PRKA) anchor protein 17A
naked mole-rat(101697463) A kinase (PRKA) anchor protein 17A
sheep(101114495) A kinase (PRKA) anchor protein 17A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005088 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118671 MISSION® esiRNA esiRNA human CXYorf3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005088 Rosetta Predictions human pricing
NM_001127246 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031698 predicted 2258
2 SASI_Hs02_00338937 predicted 2471
3 SASI_Hs01_00031700 predicted 2766
4 SASI_Hs01_00031701 predicted 490
5 SASI_Hs02_00338938 predicted 2383
6 SASI_Hs01_00031702 predicted 2468
7 SASI_Hs01_00031703 predicted 2702
8 SASI_Hs01_00031704 predicted 408
9 SASI_Hs02_00338939 predicted 1794
10 SASI_Hs01_00031705 predicted 2439
11 SASI_Hs01_00031699 predicted 2382
12 SASI_Hs01_00031706 predicted 536
13 SASI_Hs01_00031707 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253483 predicted 833
2 SASI_Rn02_00253484 predicted 1671
3 SASI_Rn02_00253485 predicted 2014
4 SASI_Rn02_00253486 predicted 1820
5 SASI_Rn02_00253487 predicted 1669
6 SASI_Rn02_00253488 predicted 1827
7 SASI_Rn02_00253489 predicted 1779
8 SASI_Rn02_00253490 predicted 1995
9 SASI_Rn02_00253491 predicted 685
10 SASI_Rn02_00253492 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005088
VALIDATED
AKAP17A MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 17A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-397s1c1
Sequence:CCGGGCGTATTTCCAAGAGCACCATCTCGAGATGGTGCTCTTGGAAATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005088.2-982s1c1
Sequence:CCGGCCTGAGTGATGCCTCAATTAACTCGAGTTAATTGAGGCATCACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-945s1c1
Sequence:CCGGCCTGCAACATCAAGGTTTCTTCTCGAGAAGAAACCTTGATGTTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1095s1c1
Sequence:CCGGGAGCGGAGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCTCCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1837s1c1
Sequence:CCGGCTCCTGCATTCCTGACAACAACTCGAGTTGTTGTCAGGAATGCAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-943s21c1
Sequence:CCGGGGCCTGCAACATCAAGGTTTCCTCGAGGAAACCTTGATGTTGCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-384s21c1
Sequence:CCGGAGTTCTCCACGCTGCGTATTTCTCGAGAAATACGCAGCGTGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-711s21c1
Sequence:CCGGACGTCCTGGTCAAGGTGTTTGCTCGAGCAAACACCTTGACCAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005088.2-2518s21c1
Sequence:GTACCGGACTTGATCCGATAGCTTTAATCTCGAGATTAAAGCTATCGGATCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-983s21c1
Sequence:CCGGCTGAGTGATGCCTCAATTAAGCTCGAGCTTAATTGAGGCATCACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005088
VALIDATED
AKAP17A MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 17A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-397s1c1
Sequence:CCGGGCGTATTTCCAAGAGCACCATCTCGAGATGGTGCTCTTGGAAATACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005088.2-982s1c1
Sequence:CCGGCCTGAGTGATGCCTCAATTAACTCGAGTTAATTGAGGCATCACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-945s1c1
Sequence:CCGGCCTGCAACATCAAGGTTTCTTCTCGAGAAGAAACCTTGATGTTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1095s1c1
Sequence:CCGGGAGCGGAGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCTCCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1837s1c1
Sequence:CCGGCTCCTGCATTCCTGACAACAACTCGAGTTGTTGTCAGGAATGCAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-943s21c1
Sequence:CCGGGGCCTGCAACATCAAGGTTTCCTCGAGGAAACCTTGATGTTGCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-384s21c1
Sequence:CCGGAGTTCTCCACGCTGCGTATTTCTCGAGAAATACGCAGCGTGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-711s21c1
Sequence:CCGGACGTCCTGGTCAAGGTGTTTGCTCGAGCAAACACCTTGACCAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005088.2-2518s21c1
Sequence:GTACCGGACTTGATCCGATAGCTTTAATCTCGAGATTAAAGCTATCGGATCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-983s21c1
Sequence:CCGGCTGAGTGATGCCTCAATTAAGCTCGAGCTTAATTGAGGCATCACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005088
VALIDATED
AKAP17A MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 17A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-397s1c1
Sequence:CCGGGCGTATTTCCAAGAGCACCATCTCGAGATGGTGCTCTTGGAAATACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005088.2-982s1c1
Sequence:CCGGCCTGAGTGATGCCTCAATTAACTCGAGTTAATTGAGGCATCACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-945s1c1
Sequence:CCGGCCTGCAACATCAAGGTTTCTTCTCGAGAAGAAACCTTGATGTTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1095s1c1
Sequence:CCGGGAGCGGAGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCTCCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005088.2-1837s1c1
Sequence:CCGGCTCCTGCATTCCTGACAACAACTCGAGTTGTTGTCAGGAATGCAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-943s21c1
Sequence:CCGGGGCCTGCAACATCAAGGTTTCCTCGAGGAAACCTTGATGTTGCAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-384s21c1
Sequence:CCGGAGTTCTCCACGCTGCGTATTTCTCGAGAAATACGCAGCGTGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-711s21c1
Sequence:CCGGACGTCCTGGTCAAGGTGTTTGCTCGAGCAAACACCTTGACCAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005088.2-2518s21c1
Sequence:GTACCGGACTTGATCCGATAGCTTTAATCTCGAGATTAAAGCTATCGGATCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005088.2-983s21c1
Sequence:CCGGCTGAGTGATGCCTCAATTAAGCTCGAGCTTAATTGAGGCATCACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)