EMAIL THIS PAGE TO A FRIEND

AKAP1

A kinase (PRKA) anchor protein 1

172 Gene Product Result for
Synonyms: AKAP AKAP121 AKAP149 AKAP84 D-AKAP1 PPP1R43 PRKA1 SAKAP84 TDRD17
UniProtKB ID: Q92667, A8K8Q1, D3DTZ0, Q13320, Q9BW14
Gene ID:
Human(8165) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]
Mouse(11640) A kinase (PRKA) anchor protein 1
Rat(114124) A kinase (PRKA) anchor protein 1
chicken(417668) A kinase (PRKA) anchor protein 1
dog(480567) A kinase (PRKA) anchor protein 1
Horse(100056722) A kinase (PRKA) anchor protein 1
cow(532072) A kinase (PRKA) anchor protein 1
domestic cat(101100767) A kinase (PRKA) anchor protein 1
naked mole-rat(101711478) A kinase (PRKA) anchor protein 1
domestic guinea pig(100723081) A kinase (PRKA) anchor protein 1
sheep(101123647) A kinase (PRKA) anchor protein 1
Domestic Rabbit(100357677) A kinase (PRKA) anchor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123321 MISSION® esiRNA esiRNA human AKAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003488 Rosetta Predictions human pricing
NM_139275 Rosetta Predictions human pricing
NM_053665 Rosetta Predictions rat pricing
NM_001042541 Rosetta Predictions mouse pricing
NM_009648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173216 predicted 2203
2 SASI_Hs02_00335764 predicted 2028
3 SASI_Hs01_00173218 predicted 687
4 SASI_Hs01_00173219 predicted 1142
5 SASI_Hs01_00173221 predicted 601
6 SASI_Hs01_00173222 predicted 1029
7 SASI_Hs02_00335765 predicted 1839
8 SASI_Hs01_00173223 predicted 1112
9 SASI_Hs02_00335766 predicted 2072
10 SASI_Hs01_00173225 predicted 2218
11 SASI_Hs01_00173217 predicted 2135
12 SASI_Hs01_00173220 predicted 638
13 SASI_Hs01_00173224 predicted 2181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155259 predicted 1118
2 SASI_Hs01_00155260 predicted 2140
3 SASI_Hs01_00155261 predicted 2135
4 SASI_Hs01_00155262 predicted 525
5 SASI_Hs01_00155263 predicted 974
6 SASI_Hs01_00155264 predicted 535
7 SASI_Hs01_00155265 predicted 1106
8 SASI_Hs01_00155266 predicted 437
9 SASI_Hs01_00155267 predicted 865
10 SASI_Hs01_00155268 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035451 predicted 1812
2 SASI_Rn01_00035452 predicted 234
3 SASI_Rn01_00035453 predicted 2234
4 SASI_Rn01_00035454 predicted 876
5 SASI_Rn01_00035455 predicted 1972
6 SASI_Rn02_00266396 predicted 1654
7 SASI_Rn01_00035457 predicted 2180
8 SASI_Rn01_00035458 predicted 1999
9 SASI_Rn01_00035459 predicted 1279
10 SASI_Rn01_00035460 predicted 2273
11 SASI_Rn01_00035456 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290565 predicted 1878
2 SASI_Mm02_00290566 predicted 2711
3 SASI_Mm02_00290567 predicted 1931
4 SASI_Mm02_00290568 predicted 840
5 SASI_Mm02_00290569 predicted 973
6 SASI_Mm02_00290570 predicted 2479
7 SASI_Mm02_00290571 predicted 2193
8 SASI_Mm02_00290572 predicted 1790
9 SASI_Mm02_00290573 predicted 2234
10 SASI_Mm02_00290574 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029170 predicted 1847
2 SASI_Mm02_00316633 predicted 2676
3 SASI_Mm01_00029171 predicted 1893
4 SASI_Mm01_00029172 predicted 798
5 SASI_Mm01_00029173 predicted 945
6 SASI_Mm02_00316634 predicted 2446
7 SASI_Mm01_00029176 predicted 2161
8 SASI_Mm02_00316635 predicted 1755
9 SASI_Mm01_00029178 predicted 2192
10 SASI_Mm02_00316636 predicted 1473
11 SASI_Mm01_00029174 predicted 2438
12 SASI_Mm01_00029175 predicted 1040
13 SASI_Mm01_00029177 predicted 1911
14 SASI_Mm01_00029179 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003488
VALIDATED
AKAP1 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-2983s1c1
Sequence:CCGGCCTTTCTTTATCCATACTGTACTCGAGTACAGTATGGATAAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1221s1c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2753s1c1
Sequence:CCGGCCAACTGGTCTTCCTCTGATTCTCGAGAATCAGAGGAAGACCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2585s1c1
Sequence:CCGGCGGCAAATCAGGTCTGACTTTCTCGAGAAAGTCAGACCTGATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1683s1c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1920s21c1
Sequence:GTACCGGGGATGCGGAAGCAGATCATTCCTCGAGGAATGATCTGCTTCCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2259s21c1
Sequence:GTACCGGAGAGCTGAACCTCACCAATATCTCGAGATATTGGTGAGGTTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2610s21c1
Sequence:CCGGCGTGGACTACGGCGGATATAACTCGAGTTATATCCGCCGTAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003488.3-3006s21c1
Sequence:CCGGCAAAGATGAACATCGGAATAACTCGAGTTATTCCGATGTTCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2080s21c1
Sequence:CCGGCACTTAGTCGGTCGGCTAATTCTCGAGAATTAGCCGACCGACTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1751s21c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1289s21c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003488
VALIDATED
AKAP1 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-2983s1c1
Sequence:CCGGCCTTTCTTTATCCATACTGTACTCGAGTACAGTATGGATAAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1221s1c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2753s1c1
Sequence:CCGGCCAACTGGTCTTCCTCTGATTCTCGAGAATCAGAGGAAGACCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2585s1c1
Sequence:CCGGCGGCAAATCAGGTCTGACTTTCTCGAGAAAGTCAGACCTGATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1683s1c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1920s21c1
Sequence:GTACCGGGGATGCGGAAGCAGATCATTCCTCGAGGAATGATCTGCTTCCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2259s21c1
Sequence:GTACCGGAGAGCTGAACCTCACCAATATCTCGAGATATTGGTGAGGTTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2610s21c1
Sequence:CCGGCGTGGACTACGGCGGATATAACTCGAGTTATATCCGCCGTAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003488.3-3006s21c1
Sequence:CCGGCAAAGATGAACATCGGAATAACTCGAGTTATTCCGATGTTCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2080s21c1
Sequence:CCGGCACTTAGTCGGTCGGCTAATTCTCGAGAATTAGCCGACCGACTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1751s21c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1289s21c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003488
VALIDATED
AKAP1 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-2983s1c1
Sequence:CCGGCCTTTCTTTATCCATACTGTACTCGAGTACAGTATGGATAAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1221s1c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2753s1c1
Sequence:CCGGCCAACTGGTCTTCCTCTGATTCTCGAGAATCAGAGGAAGACCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003488.2-2585s1c1
Sequence:CCGGCGGCAAATCAGGTCTGACTTTCTCGAGAAAGTCAGACCTGATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003488.2-1683s1c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1920s21c1
Sequence:GTACCGGGGATGCGGAAGCAGATCATTCCTCGAGGAATGATCTGCTTCCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2259s21c1
Sequence:GTACCGGAGAGCTGAACCTCACCAATATCTCGAGATATTGGTGAGGTTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2610s21c1
Sequence:CCGGCGTGGACTACGGCGGATATAACTCGAGTTATATCCGCCGTAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003488.3-3006s21c1
Sequence:CCGGCAAAGATGAACATCGGAATAACTCGAGTTATTCCGATGTTCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-2080s21c1
Sequence:CCGGCACTTAGTCGGTCGGCTAATTCTCGAGAATTAGCCGACCGACTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1751s21c1
Sequence:CCGGGCTCAGATTCTTTCAGCACTTCTCGAGAAGTGCTGAAAGAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003488.3-1289s21c1
Sequence:CCGGCCCAAGTGATCTCAGAAGCAACTCGAGTTGCTTCTGAGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009648
VALIDATED
AKAP1 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2481s1c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2435s1c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2400s1c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2330s1c1
Sequence:CCGGCCCAGTGGAAATCACGGTTATCTCGAGATAACCGTGATTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-1500s1c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009648.2-3107s21c1
Sequence:CCGGGAGTGAGACATGGACTAATTGCTCGAGCAATTAGTCCATGTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-1487s21c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2387s21c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2422s21c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2468s21c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009648
VALIDATED
AKAP1 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2481s1c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2435s1c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2400s1c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2330s1c1
Sequence:CCGGCCCAGTGGAAATCACGGTTATCTCGAGATAACCGTGATTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-1500s1c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009648.2-3107s21c1
Sequence:CCGGGAGTGAGACATGGACTAATTGCTCGAGCAATTAGTCCATGTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-1487s21c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2387s21c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2422s21c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2468s21c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009648
VALIDATED
AKAP1 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2481s1c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2435s1c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2400s1c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-2330s1c1
Sequence:CCGGCCCAGTGGAAATCACGGTTATCTCGAGATAACCGTGATTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009648.1-1500s1c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009648.2-3107s21c1
Sequence:CCGGGAGTGAGACATGGACTAATTGCTCGAGCAATTAGTCCATGTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-1487s21c1
Sequence:CCGGCCGAGAGGTGATGACAACTTTCTCGAGAAAGTTGTCATCACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2387s21c1
Sequence:CCGGGCTTCCTATGAGGAGACCAATCTCGAGATTGGTCTCCTCATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2422s21c1
Sequence:CCGGCTACGTGGACTATGGTGGATACTCGAGTATCCACCATAGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009648.2-2468s21c1
Sequence:CCGGCGGCAAATTAGGTCTGACTTTCTCGAGAAAGTCAGACCTAATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks